Help me pls
put them from least to greatest ​

Help Me Pls Put Them From Least To Greatest

Answers

Answer 1

Answer: -7/10, -0.35, 1/5, 0.95

Step-by-step explanation:

-7/10 =  -.7

1/5 = 0.2

Answer 2

Answer:

From least to greatest, the correct order is [tex]-\frac{7}{10}[/tex], -0.35, [tex]\frac{1}{5}[/tex], and 0.95.

Step-by-step explanation:

Since all negative numbers are smaller than positive, you immediately know that [tex]-\frac{7}{10}[/tex] and -0.35 are smaller than [tex]\frac{1}{5}[/tex] and 0.95. The greater the absolute value of a negative number is, the smaller that number is. Because [tex]-\frac{7}{10}[/tex] is -0.7, which has a greater absolute value than -0.35, this means [tex]-\frac{7}{10}[/tex] is the smallest number, and -0.35 is the second smallest number. Since [tex]\frac{1}{5}[/tex] is 0.2 which is smaller than 0.95, the correct order from least to greatest would be [tex]-\frac{7}{10}[/tex], -0.35, [tex]\frac{1}{5}[/tex], and 0.95.


Related Questions

HELP ME PLEASEEEE NO LINKS OR IMMA REPORT WORTH 15 POINTS

Answer choices are

1.The same or diffrent, diffrent

2. Corresponding angles, the complementary to a corresponding angle, The supplementary to a corresponding angle, The vertical angle to a corresponding angle, they are not corresponding in anyway

Answers

Answer: 1=same

Step-by-step explanation: because if you line them up they are all the same size

write 19/41 in lowest forms

Answers

Answer:

19/41

Step-by-step explanation:

this fraction cannot be simplified since 19 is a prime number.

You track the temperature from the time you you eat your lunch to the time you go to bed. you find that it drops 2 decrease each other for 10 hours. which expression that shows the change in temperature?

Answer:
-2 times 10 or
-2*10

Answers

Answer:

they both are multiplucation Which means they both increse so ether the answers are wrong or the question its self is wrong.

PLEASE HELP ASAP NO LINKS PLEASE An employee works as a veterinary assistant at a clinic making $31,840 per year. However, the clinic is hiring veterinarians at a salary of $72,100 per year. The employee went back to school to become a veterinarian. How much more money could the employee make working as a veterinarian instead of a veterinary assistant over 5 years? Enter your answer in the box.

Answers

Answer: 40,260

Step-by-step explanation:

72,100-31,840=40,260

Answer:

201,300

Explanation

I got 100 so no worries

Which inequality is true?
A.195 > 14.1
B.205 < 14.1
C.208 14.1
D.218 - 14.1

Answers

Answer:

A. 195 > 14.1

Step-by-step explanation:

Leslie has a watering can that holds 1 liter of water. She uses 250 milliliters of water on each of her plants. How many plants can she water? *remember 1L = 1000 milliliters of water

Answers

Answer:

4 plants

Step-by-step explanation:

convert the capacity of the watering can to millimeters

1L = 1000 milliliters

1 x 1000 = 1000 millimeters

Plants that can be watered = capacity of the watering can / amount of water a plant needs

1000 / 250 = 4 plants

What is the relationship between the volume of a rectangular prism and a rectangular pyramid having both congruent bases and heights?

Answers

The student will need to understand that the relationship between a prism and a pyramid with equal bases and heights is the volume of the prism is three times the volume of the pyramid. The students should physically model this relationship using manipulatives such as water, rice or beans.

Use the annual compound interest formula to find the amount in the savings account at the end of the time period and then find the total interest earned.
$8,000 at 5% for 3 years.
It is one of these answers if it helps...
$12,700 in account $4,700 interest
$10,520 in account $2,520 interest
$8,315 in account $315 interest
$9,216 in account $1,261 interest

Answers

Answer:

$9,216 in account $1,261 interest.

Step-by-step explanation:

The compound interest is given by:

[tex]a = p(1 + \frac{r}{n})^{nt} [/tex]

P = Principal

r = rate

n = Number of times interest is compounded per unit t

t = time

so:

[tex]a = 8000(1 + \frac{0.05}{1} ) ^{1 .3} \\ a = 9261[/tex]

therefore, the answer is:

$9,216 in account $1,261 interest

A tool box has the dimensions of 10 in by 7 in by 3 in. If Deena plans to double all three dimensions to build a larger tool box, she believes she would double the volume of the tool box. Is she correct?

Answers

Answer:

She will not be correct

Step-by-step explanation:

Given data

Length=10in

Width=7in

Height=3in

The volume of the toolbox

V=10*7*3

V=210 in^3

Let us double the volume and see

2V= 210*2

   =420 in^3

Let us also double the individual dimensions

Length=20

Width=14in

Height=6in

V= 20*14*6

V=1680 in^3

Hence the volume will be different, she will not be correct

what number multiples to 24 and adds to 10?

Answers

Answer:

4 and 6?

im not sure if you meant numbers

Step-by-step explanation:

17 more than twice Chrissy's height

Answers

The required expression is 2h+17 where h is the height of Chrissy.

What are expressions?

Expressions in math are mathematical statements that have a minimum of two terms containing numbers or variables, or both, connected by an operator in between.

Given is a statement, 17 more than twice Chrissy's height, we are asked to convert this statement into an expression,

Let Chrissy's height be h,

Then,

2h+17

Hence, the required expression is 2h+17 where h is the height of Chrissy.

Learn more about expressions, click;

https://brainly.com/question/14083225

#SPJ1

Look at the question below!

Answers

Answer:

the answer is 5 miles per hour

Step-by-step explanation:

because the difference between 125 and 250 is 125 and you know that's you rate of change. so we know 0 in time would also be 0 in distance. but since it's one you divide 125 by 5 = 25

Ms. Costo is shopping for a new car. The salesman tells her the price will be $18,795 before a 10% discount. Ms. Costo isn’t sure she is getting the best price, so she sends Ms. Deele to ask the price of the same car. This time the salesman tells her the price is $17,050. Who is offered the better price? What is the price of the better deal after paying the 6% sales tax?​

Answers

Answer:

Ms. Costco was offered the best price. It would be $15,900.57 after tax

Step-by-step explanation:

Ms. Costco: $18,795 x .90 =$16,915.50 x .94=$15,900.57

Ms. Deele: $17,050 x .94=$16,027

Tomás is cutting a board into 1/6 yard pieces. If the board is 3 yards long, how many pieces can Tomás cut?

Answers

The answer is 12 because 3/1/ 1/4 = 12 is is also the same as 3/0.25 because 1/4=0.25.

Problem 1. Find the total volume of both shapes. (add)
Radius 2 in
Height
6 in
Height 2 in
Length 4 in Width 1 in
HELP PLEASE

Answers

Answer:36 inches^3

Step-by-step explanation:don't know how to explain it

To visit her grandmother, Jessica takes a horse 3.31 3.313, point, 31 kilometers and a motorcycle 1 11 kilometer.

Answers

Answer: Jessica's journey in total is 4.31 km

Step-by-step explanation:

Evaluate the function.

f(x)= - x^2 - 10x

find f(-5)

Answers

Answer:

f(- 5) = 25

Step-by-step explanation:

To evaluate f(- 5) , substitute x = - 5 into f(x) , that is

f(- 5) = - (- 5)² - 10(- 5) = - 25 + 50 = 25

Find the magnitude and direction of r+u

please help !!

Answers

Answer:

a.

5.4 cm; 133 degrees

Step-by-step explanation:

hope this helps

please help me solve this question thank you​

Answers

Answer:

Step-by-step explanation:

A number was subtracted from 15. After which, that result was multiplied by 5. This result was then divided by 5 for a result of 1. Given this information, what was the initial number?

Answers

Answer:

14

Step-by-step explanation:

15-14 = 1

1*5=5

5/1=1

In slope intercept y=mx+b if the slope is 3/4 and the -y intercept is -2

Answers

Answer:

y = [tex]\frac{3}{4}[/tex] x - 2

Step-by-step explanation:

The equation of a line in slope- intercept form is

y = mx + b ( m is the slope and b the y- intercept )

Here m = [tex]\frac{3}{4}[/tex] and b = - 2 , then

y = [tex]\frac{3}{4}[/tex] x - 2 ← equation of line

Suppose that 60\%60%60, percent of adults in district A support a new ballot measure, while 45\%45%45, percent of adults in district B support the same measure. Pollsters take an SRS of 200200200 adults from district A and a separate SRS of 100100100 adults from district B to see the difference between the sample proportions (\hat{p}_\text{A}-\hat{p}_\text{B})( p ^ ​ A ​ − p ^ ​ B ​ )left parenthesis, p, with, hat, on top, start subscript, start text, A, end text, end subscript, minus, p, with, hat, on top, start subscript, start text, B, end text, end subscript, right parenthesis. What will be the shape of the sampling distribution of \hat{p}_\text{A}-\hat{p}_\text{B} p ^ ​ A ​ − p ^ ​ B ​ p, with, hat, on top, start subscript, start text, A, end text, end subscript, minus, p, with, hat, on top, start subscript, start text, B, end text, end subscript, and why?

Answers

Answer:it’s B (120 succes and 80 failures for khan academy)

Step-by-step explanation: trust me

The shape of the sampling distribution of [tex]\hat{p}_\text{A}-\hat{p}_\text{B}[/tex] is approximately normal because the number of success in district A is 120

How to determine the shape of the distribution?

The given parameters are:

Proportion of adults in district A = 60%Proportion of adults in district B = 45%Sample size of A, n = 200Sample size of B, n = 100

In the sample size of 200, the number of adults that support a new ballot measure is:

Success = 60% * 200

Success = 120

Those that oppose is

Failure = 200 - 120

Failure  = 80

If 45% supports a new ballot measure in district B, then 55% do not support

The difference between those that support and do not support is:

(55% - 45%) * 100 = 10

Hence, the sampling distribution of [tex]\hat{p}_\text{A}-\hat{p}_\text{B}[/tex] is approximately normal

Read more about normal distribution at:

https://brainly.com/question/4079902

A circular plate has circumference 30.8 inches. What is the area of this plate? Use 3.14 for t.
The area of this plate is about square inches.
(Round the final answer to the nearest whole number as needed. Round all intermediate values to the nearest
thousandth as needed.)

Answers

Answer: 745 (about)

Step-by-step explanation:

A=πr2

A =π (15.4)^2

A=π (237.16)

A= 745.06

A= 745 (with rounding)

Answer:

The area of the plate is about 76 square inches

Step-by-step explanation:

i had this on a test ... and i got this question right if your problem is worded the same way then the answer is 76 :)

Whats the maximum value?

Answers

Answer:

66

Step-by-step explanation:

Step-by-step explanation:

❤️☺️❤️☺️❤️☺️❤️☺️❤️☺️❤️☺️❤️☺️❤️☺️☺️❤️☺️❤️☺️❤️❤️❤️❤️❤️❤️☺️❤️☺️❤️❤️☺️❤️☺️❤️☺️❤️☺️❤️❤️❤️

If u know ,
Help me please .

Answers

Answer:

50cm³

Step-by-step explanation:

Multiply the dimensions then divide by three to get the volume of the pyramid

HELP ME SOMEBODY PLEASE 8 more

Answers

Answer:C

Step-by-step explanation:

I think

Answer:

D

Step-by-step explanation:

The correct answer is D because it is the lowest number. If you did the largest number it is more likely to happen.


Can someone pleaseeee help and if you’re correct i’ll give brainliest

Answers

B is the correct answer
Brainliest would be nice

Answer:

Carl is correct. So the 2nd option

Step-by-step explanation:

A rectangle- a quadrilateral

it also had 4 sides and vertices.

I hope this Helps!

What is the range of the function y=e4+1 graphed below?

Answers

56 I think y=e4+1 then you have to add and subtract

PLEASEE HELPP!!! DUE TODAYY!!!

Answers

Answer:

b 5/12

Step-by-step explanation:

A pizza pan is removed at 9:00 PM from an oven whose temperature is fixed at 425°F in a room that is constant 74°F. After 5 minutes, the pizza pan is at 300 °F



A) at what time is the temperature of the pan 130°F ?


B) determine the time that needs to elapse before the pan is 180°

Answers

Answer:

9:11:48 p.m

9.8 minutes

Step-by-step explanation:

We Obtian the slope of the relation :

Slope = Rise / Run

(0, 425) ; (5, 300)

x2 = 0 ; y2 = 425 ; x1 = 5 ; y1 = 300

(425 - 300) / (0 - 5)

125 / - 5

= - 25

The intercept :

y = mx + c

425 = - 25(0) + c

425 = 0 + c

c = 425

The equation becomes :

y = - 25x + 425

Temperature at 130

130 = - 25x + 425

130 - 425 = - 25x

-295 = - 25x

x = 11.8

9:00 + 11.8 = 9:11:48 p.m

B.)

180 = - 25x + 425

180 - 425 = - 25x

-245 = - 25x

x = 9.8 minutes

Other Questions
Line A is perpendicular to Line B. If the slope of A is -1/7, what is the slope of Line B? What are some of the jobs that geographers have?? What tone is Wordsworth using with this word below (dancing)"Fluttering and dancing in the breeze." Which of the following describes the data set 6,8,13,15,21,23,31 Help please and thatn you plzzzzzzzzzzzzzzzz ill give more points PLZ HELPWhich is the sum of 3.15 10^7 +9.3 10^6 ? Write your answer inscientific notation.A. 4.08 10^7 B. 4.08 10^6 C. 0.408 10^8D. 40.8 10^6 GIVING BRAINIEST Select the expression that represents the following statement: 45 divided by one fifth the product of 3 and 5. (4 points)Group of answer choices45 (3 x 5 x one fifth )(45 one fifth ) x 3 545 ( one fifth x 3 + 5)45 one fifth x 3 x 5 Examine the phases of the moon at the top. The fourth image is replaced by a question mark. Which statement below correctly predicts the next stage of the lunar cycle? When trying to simplify and find the equivalent resistance you should first simplify resistors in _ before simplifying those in _ LOOK AT PIC! which table shows y as a function of x? Explain how the islands of Sicily and Sardinia positively impacted ancient Romans. Income statement under absorption costing and variable costingThe following information applies to the questions displayed below.Cool Sky reports the following costing data on its product for its first year of operations. During this first year, the company produced 42,000 units and sold 34,000 units at a price of $140 per unit. Manufacturing costs Direct materials per unit $60 Direct labor per unit $22 Variable overhead per unit $8 Fixed overhead for the year $504,000 Selling and administrative costs Variable selling and administrative cost per unit $12 Fixed selling and administrative cost per year $115,0001a. Assume the company uses absorption costing. Determine its product cost per unit. 1b. Assume the company uses absorption costing. Prepare its income statement for the year under absorption costing. 2a. Assume the company uses variable costing. Determine its product cost per unit.2b. Assume the company uses variable costing. Prepare its income statement for the year under variable costing. Fire: heat as night : darkness analogy luciana is adding water to a pool Jacob was assigned recently to a large team working on a major software release that was taking longer than expected. Jacob and the other latecomers into the project spent a month partnered with a senior programmer who went over the project in detail with them and got them up to speed. Unfortunately, this training put the project even farther behind schedule. After a few months of working on the project with many other programmers, Jacob's work output becomes noticeably lower than it was before when he was working independently. Jacob's reduced work output is most likely due to Help me out. Mathmatics someone help me with this please x/12-5>-2 please help A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include short interesting story book