Find the surface area of the cone in terms of pie

Find The Surface Area Of The Cone In Terms Of Pie

Answers

Answer 1

Answer:

SA = 80π

Step-by-step explanation:

SA = πr² + πr·slant height


Related Questions

A rectangular sheet of cardboard 3 feet by 5 feet will be made into an open box by cutting equal-sized squares from each corner and folding up the four edges. A diagram of the unfolded box is provided in figure, the shaded region represents the area
that was cut from the corners of the box. What is the largest volume of such a box?

Answers

Answer:

4[tex]x^{3}[/tex] - 16[tex]x^{2}[/tex] + 15x

Step-by-step explanation:

length = 5 - 2x

width = 3 - 2x

heighth = x

x(5 - 2x)(3 - 2x)

x(15 -16x + 4[tex]x^{2}[/tex])

4[tex]x^{3}[/tex] - 16[tex]x^{2}[/tex] + 15x

The largest volume of such a box is 4.345[tex]ft^{3}[/tex].

Given that,

A rectangular sheet of cardboard 3 feet by 5 feet will be made into an open box by cutting equal-sized squares from each corner and folding up the four edges.

The shaded region represents the area  that was cut from the corners of the box.

We have to determine,

The largest volume of such a box.

According to the question,

The height will be  x

The width will be  (3 − 2 x)

And the length will be ( 5− 2 x)

.

The formula for volume will be,

[tex]Volume = Length \times Height \times Width\\\\[/tex]

Substitute the values in the formula,

[tex]Volume = x(3-2x).(5-2x)\\\\Volume = (3x-6x^{2}).(5-2x)\\\\Volume = 3x(5-2x) - 6x^{2}(5-2x)\\\\Volume = 15x - 6x^{2} - 30x^{2} + 12x^{3}\\\\Volume = 12x^{3} -36x^{2} + 15x[/tex]

 Then,

To Find the derivative of the equation,

[tex]V = 12x^{3} -36x^{2} + 15x\\\\Differentiate\ with\ respect\ to\ x\ both\ sides,\\\\\dfrac{dv}{dx} = \dfrac{d(12x^{3} -36x^{2} + 15x)}{dx}\\\\V' = 36x^{2} - 72x+15[/tex]

The critical numbers by seeing where  V '  =  0,

[tex]= 36x^{2} -72x +15\\\\= 3 ( 12x^{2} - 24x +5 )\\[/tex]

By using the quadratic formula or your calculator to solve for  

x = 0.23, and 1.6

x = 1.6 is not in the domain since that would make one of our side lengths less than zero.  x  =  0.23

Plug x back into the equations to get the dimensions,

[tex]3-2x = 3- 2 \times -0.23 = 3+0.46 = 3.46\\5-2x = 5 - 2 \times -0.23 = 5+0.46 = 5.46[/tex]

Therefore, the dimension are  0.23 ft x 3.46 ft x  5.46 ft.

Hence, The largest volume of such a box is 4.345[tex]ft^{3}[/tex].

To know more about Dimension click the link given below.

https://brainly.com/question/23288467

Find an equivalent ratio in simplest terms:
56 : 22

Answers

I think the answer is 28:11

if y=3x - 6 and x=7, then y = ??​

Answers

Answer:

y=15

Step-by-step explanation:

y=21 - 6

y = 15

hope this helped!

2. The mean weight of the students on the

Trail Middle School wrestling team is 150

pounds with a mean absolute deviation of

10 pounds. The mean weight of the

students on the Burlington Middle School

wrestling team is 130 pounds with a mean

absolute deviation of 10 pounds. By how

many pounds is the mean weight of the

students on Trail's team greater than the

mean weight of the students on

Burlington's team?

Answers

Answer:

The mean of Trail Middle School wrestling team is greater by 20 pounds as compared to that of Burlington Middle School  wrestling team

Step-by-step explanation:

Since the value of absolute deviation in case of Trail Middle School wrestling team and Burlington Middle School  wrestling team is same. Hence, there will be no impact of it while determining the difference in mean deviation of both the team.

Thus, the difference in mean deviation is [tex]150-130 = 20[/tex]

The mean of Trail Middle School wrestling team is greater by 20 pounds as compared to that of Burlington Middle School  wrestling team

A filter in the shape of a cone has a diameter of 3 inches and a height of 4 inches.
How much liquid can the filter hold without it overflowing?
A.
B.
C.
D.

Answers

Answer:

9.42 cubic inches

Step-by-step explanation:

We are to find the volume of the cone.

The formula is given as:

1/3πr²h

From the question,

Diameter = 3 inches, Radius = D/2 = 3/2

r = 1.5 inches

h = 4 inches

Hence, the volume of the cone =

1/3 × π × 1.5² × 4

= 9.42 cubic inches

Therefore, the filter can hold 9.42 cubic inches of liquid without overflowing.

Math question plz help

Answers

y=5x-3 I think so.....

1. list the pairs of alternate exterior angles
2. list the pairs of corresponding angles
3. if m<a is 112°, find the measure of the remaining angles​

Answers

Answer:

1. m<a and m<h, m<e and m<d

2.m<a and m<c, m<b and m<d, m<e and m<g, m<f and m<h

3. m<a= 112

m<c=112

m<f=112

m<h=112

m<b=68

m<d=68

m<e=68

m<g=68

Please help me with my math ASAP!

Answers

Hello !

Answer:

[tex]\large\boxed{\sf Option\ 3 : 66cm}[/tex]

Step-by-step explanation:

The circumference of a circle is given by [tex]\sf C=2\times\pi\times r[/tex], where r is the radius.

Given :

d = 21 cmr = d/2 = 10.5 cmπ =3.14

Let's replace r with its value in the previous formula :

[tex]\sf C=2\times 3.14\times 10.5[/tex]

[tex]\sf C=65.94[/tex]

[tex]\boxed{\sf C\approx 66cm}[/tex]

Have a nice day

Anne has worn a black shirt on 6 of the last 20 days. Considering this
data, how many times would you expect Anne to wear a black shirt in the
next 10 days?

Answers

Answer:

3

Step-by-step explanation:

Considering she wore a black shirt 6 times in 20 days will give you the statistic of 3/10. If the question is about the next 10 days then she will wear 3 black shirts. (It's also 1/2 of the original question.)

After 2 hours, the air temperature had risen 7° f. How long will it take at this rate for the temperature to rise an additional 13°f?

Answers

Answer:

21 hours

Step-by-step explanation:

After 2 hours the temperature has risen to 7°f

The time taken to rise to an additional 13°f can be calculated as follows

1 hour takes 3.5°f

13°f = 3.5×6

= 21 hours

Hence it would take 21 hours

Can someone help me on this plzzz and thank you

Answers

Answer:

-1.5

Step-by-step explanation:

5x6=30

30-21=9

9/6=1.5

remember tht the answer is NEGATIVE,, thnk u hav a good nite

I need help with this one. Please. thanks!

Answers

Answer: x=6

Explanation:

Get x by itself therefore subtract 6 from both sides
24 = 4x

Divide both sides by 4
6=x

Hope this helps ;)

Answer:

x=6

Step-by-step explanation:

30=6+4x

you have to combine the number that are the same, like 2 and 4 or 3x and 4x

30-6=4x (you should always remember when you move a number if it was - it will turn +)

30-6=4x

24=4x

x=24/4

x=6

what is y=36^2 x 49


HELP MEEEEEEEEE!!!!!!!!

Answers

Answer: y=36^(2)x*49

Step-by-step explanation: Graph.

Brainliest or a thank you if im right please :)) <3


© A new car cost $14875. Three years later, the insurance company valued it at $10700. Calculate the percentage
reduction in value over the three years.

Answers

Answer: either I don't understand the question or its 72% and I'm fairly certain its 72%

it would be 72% in 3 years

what is the answer to 1/3=n+3/4

Answers

Answer: n=-5/12

Step-by-step explanation: 1/3-3/4=-5/12

hoped this helped :))

Answer: n= 5/12

Step-by-step explanation: 13=+3413=n+3431​=n+43​13−34=+34−34

Hope this helps!

13 and 14, 10 points no links please

Answers

13: C
14: B
For 13, plug the 9 into the equation where b is, you get 3 • 9 = 27 (the 27 is s)
For 14, ordered pairs go horizontal distance first then vertical distance

Answer:

13 is c

14 is b

Step-by-step explanation:

“The class buys 3 bags of apples. Each bag has 24 apples. The total cost of the 3 bags of apples is $12.24. The class sells the apples for $0.75 each. How much money will the class gain per apple”

Answers

0.75 x 24 x 3 = 54

54 - 12.24 = $41.76 total profit

41.76/3 = 13.92

13.92/24 = 0.58 cents per apple
The class will gain $0.58 per apple.

Choose all the expressions that are equivalent to 4x-20.
x (4 - 20)
2 (2x - 10)
4(x - 20)
4(x - 5)

Answers

Answer:

4(x-5)= 4x-20

so the equivalent equation is 4(x-5)

Answer:

I don't actually know sorry

Step-by-step explanation:

I don't know

8. Jackie converted the following decimals to fractions. Which decimal did she
convert incorrectly?*

0.005
0.3
0.625
0.8
Please hurry and answer

Answers

Answer:

B

Step-by-step explanation:

Answer:

it's 0.625

Step-by-step explanation:

please both the question please ​

Answers

Answer: (i) 2/6=0.33 and (ii) 4/6=0.66
Explanation: if you were to add everything up there would be 17 boys and 17 girl and then you would end up with 6 people who write with their left hand and 28 people who right with their right hand. I hope this helps

Answer:

Boys: 2/17

Girls: 4/17

Step-by-step explanation:

2 + 15 = 17 (to get the total number of boys in Sapphire's class)

4 + 13 = 17 (to get the total number of girls in the class)

The proportion is how many who are left handed over the total number of girls/boys. ^^

So, left-handed for boys = 2, which makes the proportion 2/17

And there are 4 left-handed girls, so the proportion is 4/17

The temperature in an oven changes from 350 degrees to 362% What is the percent increase in temperature, to the nearest tenth of a percent?

Answers

Answer:

3.43%

Step-by-step explanation:

362-350=12

12:350*100 =

(12*100):350 =

1200:350 = 3.43

Find the radius when d=18

Answers

Answer:

9

Step-by-step explanation:

radius is half of the diameter

Yes 9 is the correct answer

what type of lines are x-3y=-3 and 6x+2y=-12

Answers

Answer:

Perpendicular

Step-by-step explanation:

A shoe store donated a percent of every sale to hospitals. The total sales were $8900 so the store donated $356. What percent of $8900 was donated

Answers

Answer:

4%

Step-by-step explanation:

Given data

The total sales= $8900

Donated amount=$356

Hence the percent donated is

=Donated amount/Total Sales *100

= 356/8900*100

=0.04*100

=4%

Hence the donated percent is 4%

what is the measure of EACH exterior angles t
of the polygon shown?​

Answers

Answer:

45 degrees

Step-by-step explanation:

The following shape is an octagon, having 8 sides and knowing that any regular polygon has an exterior angle value of 360 degrees, you can say 360/8 to find the measure of each exterior angle, leading to equal 45 degrees.

Hope it helped! (:

Solve the following quadratic equation for all values of x in simplest form.
(x – 4)^2 – 47 = 32

Answers

Answer:

x=4-√79, x=4+√79

Step-by-step explanation:

What are the angle measures of the triangle?
A. 30°, 60°, and 90°
B. 45°, 45° and 90°
C. 60°, 60°, and 60°
D. They cannot be determined.

Answers

I think A.
Is this to check

Find the surface area of each pyramid round to the nearest tenth if necessary

Answers

Answer:

457.9

Step-by-step explanation:

If a line contains the point (0, 1) and has a slope of 2, then which of the following points also lies on the line? (1,3) (3,1) (2,2) (2,3)

Answers

Answer:

(1,3)

Step-by-step explanation:

Linear equations are typically organized in slope-intercept form: [tex]y=mx+b[/tex] where m is the slope and b is the y-intercept (the value of y when the line crosses the y-axis, or when x is equal to 0).

We're given that this line contains the point (0,1). This tells us that the y-intercept (b) of the line is 1.  We're also given that this line has a slope (m) of 2. Plug these values into [tex]y=mx+b[/tex]:

[tex]y=2x+1[/tex]

Now, plug in all of the possible points to see which are solutions.

1) (1,3)

[tex]3=2(1)+1\\3=2+1\\3=3[/tex]

Because the left side of the equation is equal to the right, (1,3) also lies on this line.

2) (3,1)

[tex]1=2(3)+1\\1=6+1\\1=7[/tex]

Because the left side is not equal to the right, (3,1) does not lie on the line.

3) (2,2)

[tex]2=2(2)+1\\2=4+1\\2=5[/tex]

Because the left side is not equal to the right, (2,2) does not lie on the line.

4) (2,3)

[tex]3=2(2)+1\\3=4+1\\3=5[/tex]

Because the left side is not equal to the right, (2,3) does not lie on the line.

I hope this helps!

Find the value of angle A and angle B pls help (:

Answers

Answer:

m<A=97

m<B=97

Step-by-step explanation:

m<A=m<B

Congruent angles and they are vertical angles. The other two are also the same because the angles given have the same degrees.

m<A is supplementary to 83 degrees

Supplementary angles are two angles that sum up to 180 degrees.

180-83=97

97 degrees is the answer for each missing angles.

Other Questions
find CE 14 6 x - 5 2x + 3 ILL BRAINLIEST YOU IF YOU GET IT RIGHT What are references when applying for a job? Why should you wait before taking anti-inflammatories? HOLA POR FAVOR AYUDA:(necesito 3 ejemplos de tesis Jack invested $2,900 in an account paying an interest rate of 8 % compoundedannually. Anthony invested $2,900 in an account paying an interest rate of 81%compounded continuously. After 10 years, how much more money would Anthonyhave in his account than Jack, to the nearest dollar?I dont understand how to solve. I NEED HELP PLEASE HURRY The bank has 5 Vaults.Each vault contains 5 drawers 5 stacks and $25 whats in the bank? How many solutions will the equation have?| x 2| = 6 giving brainliest !!!!!!! What is equivalent to x+y+x+y+3(y+5)? explain the major resources of energy and write its impoetance What is the fraction equivalent of 430%NO LINKS. IF WRONG I WILL DELETE. I need this plz help In romeo and juliet passage 1 line 64, what does the phrase, content thee most closely mean?A. Be satisfiedB. Be rationalC. Be stillD. Be grateful Diego bought some raisins and walnuts to make trailmix. Raisins cost $4 a pound and walnuts cost $8 apound. Diego spent $15 on both ingredients. Decide ifeach pair of values could be a combination of raisinsand walnuts that Diego bought.Explain your answer. HELPP!!!!!!!!!!!!!!!! What transformation is shown below?reflectioncan't be determinedrotationtranslation In triangle ABC, angle A measures 50.5 degrees and angle B measures 74 degrees. What is the measure of angle C? DO NOT TRY TO PUT A DEGREE SIGN. JUST TYPE THE ANSWER!! - 1:Translate the following sequence into a short protein. Add hyphens between,please.235'- AUG GCA AAA GAG GAA CAU UAA - 3'56Second LetterUAGPheTyrSerUUUUUUCUUAUUGUCUUCCUCAUCGUAUUACUAAUAG39LeuStopStopUGUCys UUGCUGA Stop AUGG Trp GCGUCGCArgCGAGHisProCUUC | CCCUACUGCCULeu CCCCCACCGCAUCACCAACAGGin121st3rdCGGletterAsnSerlleAUUA AUCAUAAUGACUACCACAThrAAUAACAAAAAGAGUAGCAGAAGGU letterAG15Lys|ArgMet ACGAspGUUGGUCGUAGUGValAlaGCUGCCGCAGCGGAUGACGAAGAGGGUGGCGGAGGGGly|Duco18Gluhttp://biology.kenyon.edu/courses/biol114/Chap05/Chapter05.html1