Explain the mechanism of ventilation in human lungs (you should talk about the diaphragm, abdominal muscles and rib cage and intercostal muscles)

Answers

Answer 1

Answer: When the diaphragm contracts, it moves inferiorly toward the abdominal cavity, creating a larger thoracic cavity and more space for the lungs. Contraction of the external intercostal muscles moves the ribs upward and outward, causing the rib cage to expand, which increases the volume of the thoracic cavity.

Answer 2

The movement of diaphragm and ribs govern the mechanism of ventilation in human lungs.

The ventilation in human lungs or pulmonary ventilation is defined as the process of intake of air during inhalation, and expiration as the release out of air. It is also termed as breathing.

What is the mechanism of pulmonary ventilation?

The lungs are present in the thoracic cavity, with the diaphragm below the lungs separating the thoracic cavity from the abdominal cavity. The rib cage is present outside lungs and prevent them.

Inhalation process in pulmonary ventilation

The inhalation is the process of taking in air. The increase in the volume of lungs results in the increased movement of diaphragm to the abdominal cavity.

The intercostal muscles move upwards and the rib cage move outwards. Thus, the air is inhaled in the system.

Exhalation process in pulmonary ventilation

The exhalation of air is performed antagonist to the inhalation. The relaxation of diaphragm and the movement of rib cage results in the decreased volume of the lungs, and the air is expelled.

Thus, the movement of diaphragm and ribs govern the mechanism of ventilation in human lungs.

Learn more about pulmonary ventilation, here:

https://brainly.com/question/1933493


Related Questions

If water is polar, state a liquid that you think is nonpolar, and justify your answer

Answers

A gas. This is because none polar solvents contain binds between atoms with similar electronegativities, some examples are carbon and hydrogen

How can you determine the number of bonds an atom can make

Answers

Answer:

The number of bonds for a neutral atom is equal to the number of electrons in the full valence shell (2 or 8 electrons) minus the number of valence electrons. This method works because each covalent bond that an atom forms adds another electron to an atoms valence shell without changing its charge.

What form of energy is responsible for producing changes that occur in Earth’s hydrosphere?

Answers

Answer:

the sun because energy from the Sun heats the Earth unevenly. As a result, convection currents develop in the atmosphere and ocean. These redistribute heat in the atmosphere and oceans.

Answer: Hydropower is created when rapidly flowing water turns turbines inside a dam, generating electricity. Nuclear energy is produced at power plants by the process of nuclear fission. The energy created during nuclear reactions is harnessed to produce electricity.

PLEASE MARK ME BRAINLIST

There is the picture to the question

Answers

Answer:

DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD

                                                                               

HELP ME WITH THIS PLEASE I REALLY NEED HELP I WILL GIVE U BRAINLY IF U GET IT RIGHT !!

Answers

The answer is b because it prey wouldn’t be able to eat it

what are the pros and cons of online school​

Answers

Answer:

The Pros and Cons of Studying Online

Pro: Increased Flexibility. The biggest advantage to studying online is the increase in flexibility. ...

Con: Reputation. Many firms and institutions are quick to dismiss an online education. ...

Pro: Ease of Access. ...

Con: Lack of Social Interaction. ...

Pro: More Affordable. ...

Con: Fewer Courses.

Pros of Online Schools:

Time flexibility.

Availability.

24/7 access to course material..

Location flexibility.

Zero commute.

Self-Direction.

Multi-media presentations.

Variety of course options.

Cons of Online Schools:

Limited interaction with instructor.

Technology requirements.

Social interaction.

Campus environment.

Time management.

Stigma.

Credit transfer.

Financial aid.

Have a wonderful day!

If a cell has 40% solute and is placed in a solution with 60% water what will happen to the cell

Answers

There will be no net movement of water in or out of the cell.

Water moves out of the cell when a cell is placed in a hypertonic solution. This is a solution that contains more solute than does the cell. When a cell is placed in a hypotonic solution, water enters into the cell from the solution until the cell finally bursts. However, if the cell and the solution contain the same amount of solute, there is no net movement in or out of the cell.

We can see here that the cell has 40% solute and is placed inside a solution that has 60% water. This means that the solution also contains 40% solute. There will be no net movement of water in or out of the cell.

Learn more: https://brainly.com/question/2673886

Which component of the endomembrane system is responsible for packaging and preparing exist proteins in vesticles?

Answers

Answer: Golgi apparatus

Explanation: The Golgi is responsible for packaging sorting tagging and distribution.

Hope this is helpful :)

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

Super easy. Please help

Answers

Answer:

Identical twins tend to be more similar to each other than  fraternal twins do.

Explanation:

Neurons that respond to specific types of lines are examples of:
A. figure detectors.
B. top-down processors.
C. feature detectors.
D. figure processors.

Answers

Answer:

C

Explanation:

Neurons that respond to certain types of lines are examples of feature detectors found in Option C. Neurons are the monomeric units of the nervous system that play an important role in transmission.

   

What is the importance of the neuron?

The neuron is a unit in which the message is transmitted from the neuron to another neuron, and this can be done by either chemical signaling or by electric signaling. The neuron receives sensory stimuli from the sensory organ and transmits them to the spinal cord.

Later, the message from the spinal cord is sent to the motor organs, and the whole pathway of the neuron signaling from the sensory to the motor organ is called the reflex arc. The neuron takes part in the signaling process so that the muscle can function, regulate the contraction relaxation, and perform many other functions.

Hence, neurons that respond to certain types of lines are examples of feature detectors found in Option C.

Learn more about the neuron here.

https://brainly.com/question/29462317

#SPJ5

Drag the tiles to the correct boxes to complete the pairs.
Match the mRNA sequences to their DNA sequences.

Answers

1.) UUUUUAACG
2.) CCGAAAUGU
3.) AUUACGCAU
4.) GAUCAUUAC

HELP ASAP PLS IF U ANSWER U GET 40 POINTS THANKS

Answers

Explanation:

The grass help feeds the baboon. This means the baboon will have to poop out the grass. Then the dung bettle feeds off of that poop.

as a result of fertilization_____is formed​

Answers

Answer:

zygote

Explanation:

Fertilization is the process in which haploid gametes fuse to form a diploid cell called a zygote. To ensure that each zygote has the correct number of chromosomes, only one sperm can fuse with one egg.

1) How is nondisjunction related to Down syndrome and other abnormal chromosome numbers?

2) State the differences between DNA and RNA

Pleaaseeee helllpppp :(((

Answers

1. Down syndrome is usually caused by an error in cell division called “nondisjunction.” Nondisjunction results in an embryo with three copies of chromosome 21 instead of the usual two. Prior to or at conception, a pair of 21st chromosomes in either the sperm or the egg fails to separate.


2. DNA contains the sugar deoxyribose, while RNA contains the sugar ribose.


DNA is a double-stranded molecule, while RNA is a single-stranded molecule.

Choose either one ^^^

Hope this helps you.

I HAVE BEEN STUCK HERE FOR 5 MINUTES...!

Answers

vague repetitive pictures

Answer:

Should be C

Explanation:

D is wrong because standing out should mean they are spotted more easily, which means they get hunted down more often/ prey spot them easier

B is kind of weird because larger population = more competition, and I remember owls work alone

A is suspicious because they are both tawny owls and I don't understand how less food they need to be significant

C sounds plausible because the gray feather can be a "stronger" gene or something

The energy produced by respiration is the in the form of adenosine triphosphate or ____________​

Answers

Answer:

ATP

Explanation:

Adenosine triphosphate

The Milky Way galaxy was given its name because of what it looks like when viewed from Earth.
True False

Answers

Answer:

false. we cant see the whole galaxy from earth.

Answer:

the answer is false

Explanation:

we can't see the milky way (galaxy) from earth, its impossible since its so far away. unless we used a telescope maybe, not sure but for this question its false. I hope this helped!

☁️☁️☁️☁️☁️☁️☁️

A dichotomouys key is used to identify a plant. 1a. Leaves are spiny ......................Pinus taeda 1b. Leaves are broad..................... Go to 2 2a. Single leaf..........................Go to 3 2b. Many leaves....................... Go to 4 3a. Leaf edge is smooth..............Cornus florida 3b. Lead edge is rough...............Ulmus americana 4a. Leaflet edges are smooth........Albizia julibrissin 4b. Leaflet edges are rough.........Juglans nigra A plant has many broad leaves with rough edges. What type of plant is this? (1 point)

albizia julibrissin
pinus taeda
cornus florida
juglans nigra

Answers

Answer:

juglans nigra

Explanation:

I did my research and its correct I finished the quiz

1 B

2 C

3 D

4 C

5 A

The plant identified by the dichotomous key is juglans nigra.

What is a dichotomous key?

A dichotomous key is a tool used to identify any plants and animals in the ecosystem.

They are identified by their morphological traits.

The key is made up of a set of paired assertions or clues about the qualities or attributes of the organisms.

It serves as a step-by-step guide to identifying each object.

Thus, the correct option is D, juglans nigra.

Learn more about the dichotomous key, here:

https://brainly.com/question/25244481

PLS HELP!!!! 10PTS

Reproduction is not a life process still organisms spend a lot of energy on it. Give reason.

Answers

To keep their bloodline running.

Answer:

Reproduction is not a life process, but still organisms spend a lot of energy on it. ... The reproduction is not necessary to ensure living but it is required to ensure that the continuation of the living organisms and generations of the next cycle of living. It is necessary for ensuring the stability of the population.

Reproduction also helps in increasing the population of the species. All the processes which are necessary to maintain life in an organism are called life processes. Reproduction is not considered a life process because it is not necessary to maintain life.

Why would the atomic number be better to identify an element than the atomic mass?

Answers

Answer:

because the atomic number tells you how many protons and neutrons there are

Explanation:

why cant you touch your palm to your shoulder? (on the same arm)

Answers

Answer: cause

Explanation:

Some people can some cant

Some people are left handed and some people are right handed

can someone write me a essay of Photosynthesis for 30 points URGENT!!! It has to be highschool level

Answers

Answer:

Here, I got u homie!

Explanation:

Photosynthesis is the process through which green plants and other specific living organisms utilize light energy to convert water and carbon dioxide in to simple sugars. Through photosynthesis, green plants are able to manufacture their own food which is essential for their growth.

Plz give brainliest

What does the brain stem do?

Answers

Help you out with anything you’re having trouble with

Answer:

It connects the rest of the brain to the spinal cord, which runs down your neck and back. The brain stem is in charge of all the functions your body needs to stay alive, like breathing air, digesting food, and circulating blood.

Explanation:

Which of the following is not a premise of Cell Theory?
l. All cells arise from other cells.
ll. All living cells require water for survival.
lll. All living things are only composed of cells.
Choose 1 answer:
a. I only
b. ll and lll
c. ll only
d. lll only

Answers

All cellsarisefromothercells a I only

__________ is a method of wood harvesting that clears trees in an area in two or three cuts over several years.
A)
Seed-tree cutting
B)
Parthenocarpy
C)
Shelterwood cutting
D)
Selective cutting
E)
Clearcutting

Answers

Answer: E

Explanation: clearcutting

I believe the correct answer is E. Clear-cutting

Answer fast please. !!!!!!!!!!!!!!!!!!A geologist who needs to curricula to rock formations in different areas can match exposed rock layers
true or false

Answers

Answer:

A geologist who needed to correlate two rock formations in different areas could match exposed rock layers? A geologist who needed to correlate two rock formations in different areas could match exposed rock layers. TRUE.Explanation:

Answer:

true

Explanation:

Please help due in 10 minutes!
Explain how genetic drift of alleles in a small population- and- describe 2 real world examples of genetic drift (I.e. The Founder Effect and The Bottleneck Effect)

Answers

Answer:A small population is formed with a larger population.

Explanation:The population don’t represent the genetic diversity’s of the original

Population, and there smaller size mean they may experience strong drift of generations.

What is true about the insanity defense?

It is defined in the Diagnostic and Statistical Manual of Mental Disorders.
It can be used only if a person is diagnosed with a specific disorder from the DSM.
It is a legal term used to determine if a person can be held accountable for a crime.
It is a legal term that helps to determine if a person committed a crime or not.
It cannot be used if a person was previously found to be responsible for a different crime.

Answers

It is a legal term used to determine if a person can be held accountable for a crime

It's a legal term used to determine if a person can be held accountable for a crime. Hope this helps; have a wonderful day.

Mitosis and budding are similar beu
O
Both processes are components of sexual reproduction
The offspring produced by both are genetically diverse
In both, the genetic material comes from a single parent.
O O
Both processes are more common in animals than in plants.

Answers

Answer:

animals would be your awnser you are welcome  

Explanation:

Other Questions
A used automobile dealership recently reduced the price of a used compact car by 10%. If the price of the car before discount was $18,100, find the discount and the new price.The discount in price is $Thus, the new price is $ What action is an example of an "implied" power?Congress votes to raise income taxes.Congress holds an investigation on women in the military.Congress declares war on a country for sponsoring terrorism.Congress decides to close post offices in rural areas on Saturdays. If a girl walks 6km due west changes directions and walk another 5km due north. Find her displacement in both magnitude and direction f(x) = -3x + 3f(-2) = [?]Help He was impeached by the NC House of Representatives in December 1870 and convicted and removed as Governor of NC in March 1871 for "high crimes and misdemeanors in office". *A: Darrel K. RoyalB: Zebulon B. VanceC: William TryonD: William W. Holden A water bottle costs $9.45. Sales tax is 7%. What is the total cost? between 7,300 and 5,500 years ago regular monsoon rains stopped what is the first effect and second effect 4. Use SUBSTITUTION to solve the system. x= y + 5 2y + x = -4 Directions: Read the sentences. Then, rewrite each sentence by adding at least one adjective to modify a noun or a pronoun or one adverb to modify a verb, an adjective, or another adverb.Wendy found her sweater.The girl takes a bus to school.Grandfather snores loudly.A lovely butterfly landed on the flower.The weather was nasty all day.The boat raced through the water.Cows sat in the meadow.She shouted to me from the hallway.The silk shimmered like a rainbow. Have you read a detective story? what are the consequences of bad netiquette HELP HELP HELP HELP HELP HELP HELP HELP The Puck and Pawn Company manufactures hockey sticks and chess sets. Each hockey stick yields an incremental profit of $2 and each chess set, $4. A hockey stick requires 4 hours of processing at machine center A and 2 hours of processing at machine center B. A chess set requires 6 hours at machine center A, 6 hours at machine center B, and 1 hour at machine center C. Machine Center A has a maximum of 120 hours of available capacity per day, machine center B has 72 hours, and machine center C has 10 hours. If the company wishes to maximize profit, how many hockey sticks and chess sets should be produced per day this is just for fun ong sooo yeaaa **delete spaces**https://meet. go ogle. com/vqk-wfjs-dsa Does the point (6, 0) satisfy the equation y = x + 6?yes or no Write an addition, subtraction, multiplication, and division problem that all equal -3. I need help with the both of these please If you help I will mark you brainLIEST Which number is irrational?O A 317O B. 25O C. 0.5O D. 33 Using scientific methods to investigate natural phenomena has many benefits. Which of thefollowing describes a benefit of using scientific methods?A.getting results that are based on empirical evidenceB.getting only results that are scientific truthsC.getting results that do not need to be repeatedD.getting results that always support a hypothesis dinner out at nice restaurant cost $45 plus a 20% tip what was the total cost of dinner How many solutions does the system have?You can use the interactive graph below to find the answer.4x 10y = 206x 15y = -30