Answer:
the body has levels of organization that build on each other.Cells make up tissues,tissues make up organs,and organs make up organs system.
A 154-lb adult man performs a moderate level of physical activity and regularly consumes 2700 Calories a day. State whether the weight of the man will most likely decrease, increase, or remain the same. Use information from the data table to explain your answer.
The weight of the man will...
Explanation...
Answer:
Increases.
Explanation:
A 154-lb adult man regularly consumes 2700 Calories a day and performs a moderate level of physical activity, the weight of that individual increases because a 154-lb adult man needs only 2450 Calories a day and that person consumes 2700 Calories a day which is higher than their needs so these extra calories stored in their body and as a result the weight of that person increases.
the ___severs as a relay station between the hindbrain and the forebrain.
A. forebrain
B. Midbrain
C.cerebral cortex
D. hindbrain
Answer:
B. Midbrain
Explanation:
I'm pretty sure this is it.
The North Pole and the South Pole are
A:Classified as tundra biomes
B: Not home to any animals
C: not classified into major biomes.
D: Part of Aquatic Ecosystems
Answer:
A
Explanation:
classified as tundra biomes
Describe all the tissues and cell types that are found in a leaf and describe how these individual parts work together to accomplish processes of photosynthesis.
Explanation:
While individual plant species are unique, all share a common structure: a plant body consisting of stems, roots, and leaves. They all transport water, minerals, and sugars produced through photosynthesis through the plant body in a similar manner. All plant species also respond to environmental factors, such as light, gravity, competition, temperature, and predation.
please answer this urgent
Answer:
i think its a turnip because of its appearance
Which organism would look most like organism
Answer:
the last answer
Explanation:
because f,g,h both come from a so you can be sure
Astrology, look at the screenshot
Answer:
the day would get shorter.
hope it helps.
Answer:
year would get longer
Explanation:
What layer of the Earth does the upper surface of the cross-section represent? Group of answer choices Inner Core Outer Core Mantle Crust
Answer:
Hello! Your answer is...
The lithosphere is the rocky outer part of the Earth. It is made up of the brittle crust and the top part of the upper mantle. The lithosphere is the coolest and most rigid part of the Earth. The crust is the layer that you live in. The Outer and Inner Cores are hotter. The temperatures of the crust vary from air temperature on top to about 1600. The asthenosphere is the part of the mantle that flows and moves the plates of the Earth.
Explanation:
Hope this helps you! I'm new, but am really smart and nice. Hope you enjoy your time on brainly!
The crust of the Earth, the uppermost layer visible in a cross-section of the planet, is halfway through at this point. The crust, which only accounts for around 1% of the Earth's total volume, is made up of igneous, metamorphic, and sedimentary rocks.
What is the upper surface of the cross-section of Earth?The rocky exterior of the Earth is known as the lithosphere. It is composed of the uppermost layer of the upper mantle and the brittle crust. You live in the crust of the earth. It is hotter in the outer and inner cores.
The crust varies in temperature from the top air temperature to roughly 1600. The Earth's tectonic plates are moved by the asthenosphere, a region of the mantle.
Therefore, Mantle Crust layer of the Earth does the upper surface of the cross-section represent.
Learn more about Earth here:
https://brainly.com/question/14491367
#SPJ2
PLZ HELP I"LL GIVE BRAINLIEST
Answer:
gotchu
Explanation:
1. His symptoms consist of difficulty walking and an abnormal gait (pattern of movement such as walking, running, etc)
2. a. one purpose of the blood test was to test his creatine kinase enzyme to see if there were any medical conditions connected to the way he was walking and why it was abnormal
b. the other purpose is to be sure that he has something wrong with his gait. If he does have a medical condition, it was best to see if he had it early on to treat it faster
3. the function of dystrophin gene connects to the cytoskeleton of a fiber which has to do with brain function; we need that to walk. For DMD, that is a condition that alters the way people walk.
4. DMD is inherited from family's genes, so he got it from his birth family probably from his dad's part of the family as DMD effects men more than women
5. It is pretty likely as this medical condition is inheritably passed on. It is likely that his grandchild will get DMD
6. To treat DMD to the best of the ability since there isnt a cure, they could participate in physical therapy and steroids
please help ::( i wanna pass w good grades
Answer:
It's catabolism I think
Explanation:
Answer:
Catabolism
Explanation:
Catabolism: the breakdown of complex molecules in living organisms to form simpler ones, together with the release of energy; destructive metabolism.
True or False.
A group of the same species of living things in an area is a population
Answer:
True.
Explanation:
A population is a group of organisms of the same species that live in the same area at the same time
Answer:
True!
Hope this helps.
The total number of cells in an organism increases as a result of which process?
A respiration
B. photosynthesis
C cell division
D fermentation
Answer:
I am pretty sure that the answer is C.
Hopes this helps.
Have a great day!!!!!!!
Which kind of worm is sometimes used to prevent blood clots?
planarian
leech
fluke
hookworm
Answer:
Leech
Explanation:
leeches suck our blood so when a blood clot appears they can fix it by sucking our blood so the blood does not effect.
Answer:
a leech i got it correct on edu!
Explanation:
What are the potential advantages and disadvantages of a major shift from the hard or traditional path of energy development to the soft or visionary path?
(These were the corresponding textbook pages, if needed) Please read the following from the textbook Environmental Science:
7th Edition - Chapter 17
9th Edition - Chapter 14
Answer:
Advantages of following the soft path, the argument here is alternative sources of power such as hydropower, geothermal energy , wind energy , and photovoltaic cells must be developed. This provides a alternative source to remain in a healthy environment and also function as the society we currently live in using the hard path. Disadvantages of following the hard path result with future generations fearing over the irreversible damage of climate change and the damage done to our atmosphere. The hard path argue that we should continue to operate in the future as we have in the past, except more efficiently. This is close to impossible and will only continue the negative effects the hard path( the path we have been following) results in. The major shift determines the outcome of this world, the futures worries or reliefs and ultimately the survival of humans.
Explanation:
Which of the following is a macronutrient?
A) iron B) boron C) Calcium D) Manganese
Explain the role that hooved animals, such as cows, play in regenerative farming.
Answer:
I hope this helps
Explanation:
As animals move, their hooves break up the soil, compacting inedible plants and allowing nutrients and sunlight to new plants—essentially speeding up the building of soil organic matter, with crushed leaves and stalks creating a natural mulch. This better equips the soil for germinating seeds.
Surface mining is less dangerous and more profitable than subsurface mining
Answer:
Surface mining is the extraction of mineral and energy resources near Earth's surface by first removing the soil, subsoil, and overlying rock strata. ... Surface mining disturbs the land more than subsurface mining, but subsurface mining is more expensive and dangerous.
Explanation:
A student uses a marble simulation to illustrate genetic drift. She starts with a
population of 50 individuals, represented by 25 red marbles and 25 blue marbles.
The red marbles represent an allele for pointed ears ih mice, and blue marbles
represent an allele for rounded ears. Which statement below is true?
The allelic frequency for rounded ears is 25.
The allelic frequency for pointed ears is 75 (75%).
The allelic frequency for rounded ears is 1.0.
The allelic frequency for pointed ears is 0.5 (50%).
Answer:
The allelic frequency for pointed ears is 0.5 (50%).
Explanation:
The frequency of alleles in a population must add up to 1 (100%).
The allelic frequency for pointed ears is 0.5 (50%).
What is allelic frequency ?The allele frequency represents the incidence of a gene variant in a population. Alleles are variant forms of a gene that are located at the same position, or genetic locus, on a chromosome.
What is the difference between gene frequency and allele frequency?Gene frequency, which more or less refers to the allele frequency, is the measurement where the number of repeats of the same allele is measured over a certain period of time.
To learn more about allelic frequency , here
https://brainly.com/question/23362399?referrer=searchResults
#SPJ2
What is the definition for polyploidy?
why do people like sparkling water?
Answer:
maybe they think it will make them magical?
Explanation:
Each of the following is a density-dependent limiting factor EXCEPT:
- crowding
- predation
- competition
- disease
Answer:
predation
Explanation:
predation
I hop this answer is correct
Answer:
Disease
Explanation:
PLZZ HELP IM DOING A UNIT ASSESMENT!!!!
What types of cells would contain cell walls and what types of cells would contain a cell membrane?
Answer:
I agree with the other person
have a good day :)
Explanation:
what is the genotype for: A man normal for blood clotting:
Answer:
Genotypes: A man with hemophilia is XhY where h = hemophilia gene and H = the normal gene. ... Her genotype must be: XhXH and NOT XHXH We can use a Punnett square to show the probability of a daughter or son having hemophilia.
Construct an argumentative paragraph. Do you believe it's ethical or unethical to artificially select traits in plants and or animals? Provide evidenco to suoport your claims. It doesn't matter what side you chose, but I need it asap.I will give you any mark you want.
Answer:
The ethics of artificially inserting traits in animals has been in the practice for years in the form of selective breeding, but should scientists really be editing DNA to the extent they are today? I don't believe they should. Life itself should construct itself without us interfering. Making a brand new plant just because it looks nice doesn't account for many factors, including the fact that it could be harmful to nearby plants if pollinated. In addition, generic engineering costs quite a lot of money, which should be used on other more cost effective methods, such as improving agriculture rather than creating a whole new plant that could harm entire crops. Genetic engineering isn't a necessity and humans should not play God with plant and animal life.
Pls, I need help with this! Biology Thank you :)
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
How is fish adapted? Write any two adaptational characters of them.
What is a simple diffusion?
Answer:
movement of a solute from an area of high concentration to an area of low concentration
Explanation:
the question are in the Picture:) Please help me :)
Answer:
Birds
Explanation:
1. Wings
2. Flight feathers and beak
3. For survival purposes
7._________________________ lines your digestive tract and blood vessels. It moves food and blood through your body.
smooth muscle
skeletal muscle
cardiac muscle
Answer:
Smooth Muscle
Explanation:
In the digestive tract it's called the muscularis mucosa.
what would the chromosome to the right be called?
Answer:
The two identical chromosomes that result from DNA replication are referred to as sister chromatids. Sister chromatids are held together by proteins at a region of the chromosome called the centromere. Chromosomes undergo additional compaction at the beginning of mitosis.
Explanation:
Based on the position of centromere and length of chromosomal arms, the chromosomes are classified into 4 groups:
(1). Telocentric chromosomes.
(2). Acrocentric chromosomes.
(3). Sub-metacentric chromosomes.
(4). Metacentric chromosomes.
