Every 3 bases (a codon) in the RNA codes for 1 amino acid.
Example: CCA codes for proline (pro)
2. Write the amino acid that corresponds to each codon.
CGG
CUG
AGC
CAG

Answers

Answer 1

Answer:

Lysine

Leucine

Serine

Glutamine


Related Questions

Which of the following are prokaryotic cells?

A) plants

B) fungi

C) bacteria

D) animals

E) B and C only

Answers

fungi, bacteria

If I remember right, eukaryotic means there's more than one, so I believe this answer is right

The Answer is c: bacteria

The coronavirus attaches to a membrane protein called

Answers

Answer:

M glycoprotein..

The coronavirus attaches to a membrane protein called M glycoprotein..

Hey My Name is Chloe, and I need some Help, But if you can't it's ok,

So I need Some Facts and Topics on Land Animals, I did some research But I didn't find enough. Any Is fine

Answers

Answer: CHIMPANZEES. RECKONED to be the most-intelligent animals on the planet, chimps can manipulate the environment and their surroundings to help themselves and their community. They can work out how to use things as tools to get things done faster, and they have outsmarted people many a time.

Explanation:

Answer: Animal: Bengal tigers

Topics: Why are bengal tigers being hunted? How many bengal tigers are left in the world?  Are bengal tigers being bred in captivity.

Facts:The White Tiger is one of the rarer relatives of the big cats. Due to their white coat they are often referred to as the bleached tiger. White Tigers are in fact a subspecies of Tigers and are the pigmented variation of the Bengal Tiger, sometimes found in the wild on the Indian subcontinent.

Explanation: I would suggest looking at national geographic if you want cooler animals.

What is the purpose of cellular respiration. In a short sentence

Answers

Answer:

Produce energy (in the form of ATP) for metabolic processes and muscle contraction.

Explanation:

What is the definition for polyploidy?

Answers

containing more than two homologous sets of chromosomes.

Try to move the different parts of the body
by moving it back and forth, side to side,
rotating, and swinging.​

Answers

The given question is incomplete, however, the missing part is as follows:

body parts movement

neck _____

lower arm _______

upper arm ________

wrist __________

shoulder _________

skull _________

knee _________

hipbone _________

elbow _________

ankle _________​

Answer:

The correct answer is given as follows:

Explanation:

A. side to side

B. swinging

C. rotating

D. rotating

E. rotating

F. back and forth

G. swinging

H. side to side

I. back and forth

J. rotating

What do coal deposits tell you about the continents?

Answers

Answer:

Coal deposits are found in sedimentary rock basins, where they appear as successive layers, or seams, sandwiched between strata of sandstone and shale.

At the zoo, Anya observes that individuals of a certain kangaroo species have slightly different sizes and colors. What characteristic of populations is Anya observing?

O adaptation
O evolution
O selection
O variation

Answers

The answer is variation, because the same species can vary in color and sizes

What can we say about the
kinetic energy of the particles
in this object?
A. It has very low energy
B. It has medium energy
.
C. It has very high energy

Answers

C

Energy will gather together

How do antibiotics work? Note: you will not be given credit for simply stating “they prevent bacterial growth” or “they kill bacteria”

Answers

Antibiotics stop infections caused by bacteria, they kill it , and/or keep them from copying themselves or reproducing . antibiotic means against life, so any drugs in your body is technically an antibiotic. they attack the wall or coating surrounding the bacteria

Answer:

here's your answer

Explanation:

May this helps you..

What are the two resulting cells formed from single cell called

Answers

"Daughter cells" is the correct answerThe cell that splits is called the "parent cell" and the two cells that form are called the "daughter cells".Please let me know if I am wrong.

PLZ HELP I"LL GIVE BRAINLIEST

Answers

Answer:

gotchu

Explanation:

1. His symptoms consist of difficulty walking and an abnormal gait (pattern of movement such as walking, running, etc)

2. a. one purpose of the blood test was to test his creatine kinase enzyme to see if there were any medical conditions connected to the way he was walking and why it was abnormal

b. the other purpose is to be sure that he has something wrong with his gait. If he does have a medical condition, it was best to see if he had it early on to treat it faster

3. the function of dystrophin gene connects to the cytoskeleton of a fiber which has to do with brain function; we need that to walk. For DMD, that is a condition that alters the way people walk.

4. DMD is inherited from family's genes, so he got it from his birth family probably from his dad's part of the family as DMD effects men more than women

5. It is pretty likely as this medical condition is inheritably passed on. It is likely that his grandchild will get DMD

6. To treat DMD to the best of the ability since there isnt a cure, they could participate in physical therapy and steroids

A student uses a marble simulation to illustrate genetic drift. She starts with a
population of 50 individuals, represented by 25 red marbles and 25 blue marbles.
The red marbles represent an allele for pointed ears ih mice, and blue marbles
represent an allele for rounded ears. Which statement below is true?
The allelic frequency for rounded ears is 25.
The allelic frequency for pointed ears is 75 (75%).
The allelic frequency for rounded ears is 1.0.
The allelic frequency for pointed ears is 0.5 (50%).

Answers

Answer:

The allelic frequency for pointed ears is 0.5 (50%).

Explanation:

The frequency of alleles in a population must add up to 1 (100%).

The allelic frequency for pointed ears is 0.5 (50%).

What is allelic frequency ?

The allele frequency represents the incidence of a gene variant in a population. Alleles are variant forms of a gene that are located at the same position, or genetic locus, on a chromosome.

What is the difference between gene frequency and allele frequency?

Gene frequency, which more or less refers to the allele frequency, is the measurement where the number of repeats of the same allele is measured over a certain period of time.

To learn more about allelic frequency , here

https://brainly.com/question/23362399?referrer=searchResults

#SPJ2

the question are in the Picture:) Please help me :) ​

Answers

Answer:

Birds

Explanation:

1. Wings

2. Flight feathers and beak

3. For survival purposes

What do you think would have the greatest effect on the body—a harmful mutation in a pluripotent embryonic stem cell

Answers

Answer:

This question lacks options, the complete question is: What do you think would have the greatest effect on the body—a harmful mutation in a pluripotent embryonic stem cell, or a harmful mutation in an adult multipotent stem cell?The correct answer is a harmful mutation in a pluripotent embryonic stem cell.

Explanation:

Pluripotent Stem Cells can self-renew and differentiate into any of the three germ layers, which are: the ectoderm, the endoderm and the mesoderm. These three germ layers subsequently differentiate to form all the tissues and organs within a human being. If during embryonic development, genetic mutations - alterations in genes - occur in the embryonic stem cell, they pass to daughter cells as a consequence of cell division, and an individual is generated whose cells differ at the genetic level. Multipotent stem cells are organospecific cells, that is, they can give rise to any type of cells but from a specific organ (a lung, a kidney or the brain). Their differentiation ends the moment they specialize and become a cell with a specific function within a specific tissue or organ. If there were a mutation in these cells, it would damage a specific designed tissue or organ.

A 154-lb adult man performs a moderate level of physical activity and regularly consumes 2700 Calories a day. State whether the weight of the man will most likely decrease, increase, or remain the same. Use information from the data table to explain your answer.

The weight of the man will...
Explanation...

Answers

Answer:

Increases.

Explanation:

A 154-lb adult man regularly consumes 2700 Calories a day and performs a moderate level of physical activity, the weight of that individual increases because a 154-lb adult man needs only 2450 Calories a day and that person consumes 2700 Calories a day which is higher than their needs so these extra calories stored in their body and as a result the weight of that person increases.

Which kind of worm is sometimes used to prevent blood clots?

planarian
leech
fluke
hookworm

Answers

Answer:

Leech

Explanation:

leeches suck our blood so when a blood clot appears they can fix it by sucking our blood so the blood does not effect.

Answer:

a leech i got it correct on edu!

Explanation:

Pls, I need help with this! Biology Thank you :)

Answers

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

What is a simple diffusion?

Answers

Answer:

movement of a solute from an area of high concentration to an area of low concentration

Explanation:

The North Pole and the South Pole are

A:Classified as tundra biomes

B: Not home to any animals

C: not classified into major biomes.

D: Part of Aquatic Ecosystems​

Answers

D part of aquatic ecosystems

Answer:

A

Explanation:

classified as tundra biomes

I neeed helppppppp

Chemical Weathering 5 facts about it

Answers

Answer:

5 Facts

Explanation:

1. When it comes to chemical weathering, it’s all about chemistry. By looking at the term “chemical weathering,” you can see that a chemical reaction causes something to break down or “weather.” That “something” is rocks and minerals.

2. In chemical weathering, rocks and minerals are reacting to acids, oxygen, carbon and water. That’s why no two rocks ever look exactly the same. It’s also the reason that we have those awesome looking caves and unique rock formations all over the world.

3. While chemical weathering creates nifty formations, the way it breaks down rocks also causes fractures in ancient structures like the Great Sphinx of Egypt. It also causes the surface to break down on gravestones.

4. Chemical weathering types can work separately, but they often work together to create landforms and break down minerals.

5.  Acid rain caused by pollution such as factory and car exhaust is another agent of chemical weathering.

Question 1/7 The Nile River carries sediments to the ocean. Over time, the sediments are compressed as more sediments are deposited on top of them. Which type of rock will be formed?​

Answers

Answer:

Sedimentary Rock

Explanation:

Sedimentary rocks are formed from pieces of sediments or other existing organic matter or rock.

The sedimentary rock formation process begins with weathering which involves the breakdown of the sediments into small fragments. The next process is erosion, where water like the Nile River carries them to other places -  in this case, the Ocean.

Over time, the sediments settle and become compressed as more sediments are deposited on top of them.

This leads to the formation of Sedimentary Rocks.


True or False.
A group of the same species of living things in an area is a population

Answers

Answer:

True.

Explanation:

A population is a group of organisms of the same species that live in the same area at the same time

Answer:

True!

Hope this helps.

Each of the following is a density-dependent limiting factor EXCEPT:

- crowding
- predation
- competition
- disease

Answers

Answer:

predation

Explanation:

predation

I hop this answer is correct

Answer:

Disease

Explanation:

The total number of cells in an organism increases as a result of which process?
A respiration
B. photosynthesis
C cell division
D fermentation

Answers

Answer:

I am pretty sure that the answer is C.

Hopes this helps.

Have a great day!!!!!!!

It is fermentation... bc it’s the total number

Construct an argumentative paragraph. Do you believe it's ethical or unethical to artificially select traits in plants and or animals? Provide evidenco to suoport your claims. It doesn't matter what side you chose, but I need it asap.​I will give you any mark you want.​

Answers

Answer:

The ethics of artificially inserting traits in animals has been in the practice for years in the form of selective breeding, but should scientists really be editing DNA to the extent they are today? I don't believe they should. Life itself should construct itself without us interfering. Making a brand new plant just because it looks nice doesn't account for many factors, including the fact that it could be harmful to nearby plants if pollinated. In addition, generic engineering costs quite a lot of money, which should be used on other more cost effective methods, such as improving agriculture rather than creating a whole new plant that could harm entire crops. Genetic engineering isn't a necessity and humans should not play God with plant and animal life.

please help ::( i wanna pass w good grades

Answers

Answer:

It's catabolism I think

Explanation:

Answer:

Catabolism

Explanation:

Catabolism: the breakdown of complex molecules in living organisms to form simpler ones, together with the release of energy; destructive metabolism.

what would the chromosome to the right be called?

Answers

Answer:

The two identical chromosomes that result from DNA replication are referred to as sister chromatids. Sister chromatids are held together by proteins at a region of the chromosome called the centromere. Chromosomes undergo additional compaction at the beginning of mitosis.

Explanation:

Based on the position of centromere and length of chromosomal arms, the chromosomes are classified into 4 groups:

(1). Telocentric chromosomes.

(2). Acrocentric chromosomes.

(3). Sub-metacentric chromosomes.

(4). Metacentric chromosomes.

PLEASE ANSWER ASAPP!! WILL GIVE BRAINLIEST
Match the following peer pressure tactics to the definitions. (unspoken pressure, rejection, insults, and reasoning)

Communicating verbally and nonverbally

Attempting to convince peers to alter their beliefs

Excluding or ignoring

Dressing a certain way or participating in a certain activity

Answers

Answer:

excluding or ignoring= rejection

Dressing a certain way or participating in a certain activity= unspoken pressure

Attempting to convince peers to alter their beliefs= pressure

Communicating verbally and nonverbally= insults (?)

Match each term to the appropriate description.

Answers

Answer:

Have a great day!

Explanation:

The appropriate term for each description would be ecosystem, community, population, organism, and species respectively.

Definition of ecological terms?

An ecosystem is a community of all living organisms interacting with their environment as a system.

A community is a collection of different populations of organisms.

A population is a group of organisms of the same species capable of mating.

Species are a group of organisms that is capable of breeding to produce fertile offspring.

Thus, the term for each description would be ecosystem, community, population, organism, and species respectively.

More on ecological terms can be found here: https://brainly.com/question/13046612

#SPJ2

Other Questions
This year, the cost of an amusement park pass is twenty percent more than last year. This year's cost is described by an expression where p is last year's cost. p + 0.20pWhich of these expressions is another way to describe this year's cost? whats the answer Which scale factor was applied to the first rectangle in the resulting image?Enter your answer as a decimal in the box I need help on this.. And I will give you a BRANILIST if you the first one with the right answer Why do economists use market values when calculating GDP? The equation below represents the process that you observed. Balance the equation. What type of reaction?6CO2 + 6H2O + light energy = 0C6H12O6 + 6O2 _______________________ Solve for b can someone help me please find 6 ,7,8,9WILL GIVE BRAINLIST!!!! A family business had bred dogs for over 250 years. During this time, 125 generations of dogs were bred for a single trait: protective instincts. Immediately afterbirth, the puppies are sorted based on whether or not they have a white patch of fur on their chests. Those without this trait, are no longer bred for theirbusiness and instead are adopted to pet stores and not private sales for people requesting the desired trait of protective instincts.How could the breeders know these other dogs will not have the traits they are looking for when they are just new-born puppies? how can we enjoy clean and healthy environment true or false the only reason to protect intellectual property is financial? Two students are on a balcony a distance h above the street. One student throws a ball vertically downward at a speed vi; at the same time, the other student throws a ball vertically upward at the same speed. Answer the following symbolically in terms of vi, g, h, and t. (Take upward to be the positive direction.)(a) What is the time interval between when the first ball strikes the ground and the second ball strikes the ground??t = ______(b) Find the velocity of each ball as it strikes the ground.For the ball thrown upward vf = ______For the ball thrown downward vf = ______(c) How far apart are the balls at a time t after they are thrown and before they strike the ground?d = _______ I seriously need help on this. A physical education teacher shares 21 bean bags equally between 4 students. The number of bean bags that each student gets lies between what two whole numbers. A: 3 and 4 B: 5 and 6 C: 2 and 3 D: 7 and 8 Ethics are not a consideration in which one of the following fields of research? Or do ethics enter in all of these fields?a)Natural sciencesb)psychologyc)Medicald)ethics enter in all of them please helpppppdue in 15 minsssss helpppp plz i will give 5 stars say thanks and i will mark right answer brainliestSOLVE FOR q10.63 = q 5.63 you guys are smart, which revision corrects the inappropriate shift in verb voice? Ann wants to spend at most \$8.50 on school supplies. She needs to purchase a binder ( costs $6.89) and wants to spend the rest on pens, which cost $ 0.59 each. Which inequality represents this situation, where x is the number of pens Ann can buy?A. 0.59x + 6.89 < 8.50B. 0.59x + 8.50 < 6.89C. 6.89x + 0.59 < 8.50D. 8.50x + 6.89 < 0.59Please help Please help me I don't understand Researchers in plant growth are investigating the proportions of seedlings that sprout under two environmental settings in a lab experiment. Let pC represent the sample proportion of seedlings that sprout in garden C, and let pH represent the sample proportion of seedlings that sprout in garden H. For random samples of 100 garden C seedlings and 100 garden H seedlings, the sampling distribution of the difference between sample proportions pCpH has pCpH0.051. Which of the following is the best interpretation of PCPH0.051 ? 1. Lawrence's parents pay him a base allowance of $10 per week and $3.20 per hour for extra chores he completes.Mr. Williams pays Lawrence $7.80 per hour to fix broken washing machines at the laundromat. Which equationmodels Lawrence's total weekly income?