During the Gilded Age many new businesses emerged which created the wealthiest people the country had ever seen.

If you lived in this time what would your role have been? A captain of industry or a worker? Explain why you think that.

Answers

Answer 1

My role would have been that of a captain of industry in the Gilded age. Irrespective of my economic status, I would have preferred to be boss to others other than being a subordinate. Creating wealth is just an initiative, I would see what can be started with my little savings to avoid being bossed around and facing life risking jobs.

What constitutes the Gilded Age?

The Gilded Age was a period of rapid industrialization and economic growth in the United States. John D. Rockefeller, Andrew Carnegie, J.P. Morgan, and others were captains of industry during this period.

Industrialists were wealthy, powerful, and influential individuals who played an important role in shaping the American economy and society. On the other hand, workers often worked in factories, mines, and other industries. They worked long hours for little pay and had little job security or benefits.

Therefore, my role would have been that of a captain of industry. Irrespective of my economic status, I would have preferred to be boss to others other than being a subordinate.

learn more about Gilded age: https://brainly.com/question/28145617

#SPJ1


Related Questions

The fresco cycle of the life of Christ in the Arena Chapel of Padua was painted byA. CimabueB. GiottoC. MasaccioD. Fra Angelico

Answers

Giotto's use of light and shadow, perspective, and spatial composition helped to create a sense of depth and realism in the frescoes, setting a new standard for painting in Italy. The correct answer is B. Giotto.

His work in the Arena Chapel had a profound influence on the development of Renaissance art and continues to be admired and studied by art historians and scholars today.

The fresco cycle of the life of Christ in the Arena Chapel of Padua was painted by the Italian artist Giotto di Bondone (c. 1267-1337).

The Arena Chapel, also known as the Scrovegni Chapel, was commissioned by Enrico Scrovegni, a wealthy Paduan banker, in the early 14th century.

Giotto's frescoes in the chapel are considered to be a masterpiece of Western art and a turning point in the development of Italian Renaissance art.

The cycle depicts scenes from the life of Christ, from the Annunciation to the Last Judgment, and is notable for its emotional intensity, naturalistic style, and careful attention to details of human anatomy and movement.

to know more about Giotto's frescoes refer here:

https://brainly.com/question/19613771#

#SPJ11

How does Lee Coker respond to Amos Hicks and his criticism of Janie?

Answers

How does Lee Coker respond to Amos Hicks and his criticism of Janie? Lee Coker know that Hicks is pretending that he doesn't like Janie only to make himself feel better after Janie rejected him.

true or false

the soviet union is to blame for the beginning of the cold war

explain your opinion- who was to blame for the breakdown of post war talks between the U.S. and the USSR? why?

Answers

Answer - False
Explanation - Though it could be argued either way, the main event that, in my opinion, truly sparked hatred between the west and the USSR was a combination of Winston Churchills iron curtain speech essentially denouncing all soviet politics and saying they were helping communism grow in Europe, as well as what Churchill himself called the “Iron Curtain” - The rapid expansion of communism across Eastern Europe and the balkans, as well as in China, Korea and other parts of Asia.

Why was Nigeria formerly under a command economic system?

Answers

Nigeria formerly operated under a command economic system because type of centrally planned economy.

This system was implemented in the 1960s when Nigeria gained independence from Britain. The main goal of the command economic system was to reduce income inequality and promote industrialization. Under this system, all production and pricing decisions were made by the government.

The government would control all imports, exports, and foreign investment. It would also determine wages and prices for goods, as well as regulate all business activities. This system ultimately failed due to corruption and lack of incentives for producers, leading to an inefficient economy with high levels of poverty.

To know more about command economic system visit:

https://brainly.com/question/28423244

#SPJ4

Which statement about Joan of Arc is true?

Responses

Answers

Option B is one that accurately describes Joan of Arc, she said that she had received command from God to lead French troops in combat with English invaders.

Who is Joan of Arc?

Joan of Arc, also known as the Maid of Orleans, was a French national heroine who played a pivotal role during the Hundred Years' War between England and France. Born in 1412 in Domrémy, France, she claimed to have received visions from God instructing her to lead the French army to victory against the English. At the age of 17, she convinced the French Dauphin to allow her to lead the army and she subsequently won several key battles, including the lifting of the siege of Orleans. She was found guilty and burned at the stake in 1431, but was later exonerated by the Catholic Church and canonized as a saint in 1920.

Learn more about Joan of arc here,

brainly.com/question/497316

#SPJ1

Complete Question:

Which statement about Joan of Arc is true?

A. She was a Benedictine nun who predicted that France would fall to King Edward III.

B. She said that God had told her to lead French troops against the English invaders.

C. She was executed by King Charles of France for losing the Battle of Crecy.

D. She commanded English forces in a siege against the French city of Orléans.

Many settlers in Florida and Georgia were upset with the Seminoles because they
A. attacked Spanish forts without warning.
B. provided safe havens for runaway slaves.
C. declared loyalty to the French government.
D. competed with southern agricultural exports.

Answers

Option B is entirely correct. Many settlers in Florida and Georgia were upset with the Seminoles because they provided safe havens for runaway slaves.

What exactly are seminoles?

The Seminoles are a Native American tribe that first appeared in Florida in the 18th century. Today, they are divided into three federally recognised tribes: the Seminole Indian Nation of Oklahoma, the Seminole Tribe of Florida, and the Miccosukee Tribe of Indians of Florida, as well as autonomous organisations. The Seminoles evolved from several Native American groups who immigrated in Spanish Florida beginning in the early 1700s, most notably the northern Muscogee Creeks that originated in what is now Georgia and Alabama.

To know about seminoles visit:

https://brainly.com/question/15526672

#SPJ1

Safety net programs include…

Answers

1. Medicaid
2. Supplemental Nutrition Assistance Program (SNAP)
3. Temporary Assistance for Needy Families (TANF)
4. Supplemental Security Income (SSI)
5. Earned Income Tax Credit (EITC)
6. Head Start
7. Housing Assistance
8. Child Care Assistance
9. Low-Income Home Energy Assistance Program (LIHEAP)
10. Unemployment Insurance (UI)
11. Social Security Disability Insurance (SSDI)
12. National School Lunch Program.

Why do you think the Quakers and others on the Underground Railroad provide shelter to the runaways?
A. They help for humanitarian and religious reasons.
B. They are Northerners who are against Southerners.
C. They like Harriet Tubman.
D. They wanted to gain political advantage in the North.

Answers

The Quakers and others on the Underground Railroad provided shelter to runaway slaves for (Option A) humanitarian and religious reasons, not for political gain or personal preferences.

The Quakers, a religious group that believed in the equality of all human beings, felt that it was their moral duty to help those who were oppressed and suffering.

Additionally, the Underground Railroad was not a political organization, but a network of people who were dedicated to helping slaves escape to freedom.

Those who participated in the Underground Railroad did so at great personal risk, as it was illegal to aid runaway slaves. Therefore, it is unlikely that they would have risked their safety for political gain or personal preferences.

Furthermore, the Underground Railroad was not solely operated by Northerners who were against Southerners. It was a network of people who shared a common goal of helping slaves escape to freedom.

While there were certainly individuals in the North who were against slavery and supported the abolitionist movement, the Underground Railroad was made up of people from all walks of life and from various regions of the country.

In conclusion, the Quakers and others on the Underground Railroad provided shelter to runaway slaves out of a sense of (Option A) humanitarianism and religious duty, not for political gain or personal preferences.

They believed in the equality of all human beings and were willing to risk their own safety to help those who were oppressed and suffering.

For more question on "Quakers" :

https://brainly.com/question/23938089

#SPJ11

8) How free were Americans (in particular, women, African-Americans, and Japanese-Americans) in the years before and during World War II? To answer this question, you should use the Four Freedoms—as defined by the President and Norman Rockwell—as the standard.

Answers

Many Japanese Americans were forced to live in poor, cramped circumstances with barbed wire fences around them and armed guards for many years.

Japanese Americans lost not only their homes, companies, property, and money but also their liberty, security, and fundamental liberties that are equally the property of all Americans. I have always held the opinion that great countries confront their most trying times head-on, learn from them, and become stronger as a consequence.  

The imprisonment of Japanese Americans 80 years ago serves as a warning to us about the awful results we invite when we let racism, xenophobia, and other forms of bigotry thrive.

Learn more about Japanese Americans here:

https://brainly.com/question/14585867

#SPJ4

What was the one major advantage that allowed the small Portuguese fleet to dominate the Indian Ocean militarily?

Answers

The one major advantage that permitted the little Portuguese armada to rule the Indian Sea militarily Their installed gun could overcome different boats and beachfront fortifications.

Europeans had found the subtle water course to the rewarding Indian Sea exchange organization. The Portuguese technique in the Indian Sea was to overwhelm exchange using capability, terrorizing, and ruthlessness. their boats could outgun and outsmart contending maritime powers.

Their boats could outgun and outsmart contending maritime powers, while their installed cannons could annihilate beachfront fortresses. The point of Portugal in the Indian Sea was to guarantee the imposing business model of the flavor exchange.

Learn more about Portuguese:

https://brainly.com/question/31344706

#SPJ4

They made farmers devote valuable land to cash crops like cotton and tried to compile subsistence farmers to modernize by charging them taxes What are the cons of colonial powers?

Answers

The cons of colonial powers include exploiting native resources, forcing cash crops on farmers, imposing taxes, subjugating the local population, erasing native culture and identity, and creating a legacy of inequality and instability.

Colonial powers often saw their colonies as sources of raw materials and labor to fuel their own economies. This resulted in the exploitation of native resources and people, with little regard for their welfare. Colonial powers also forced farmers to grow cash crops like cotton, which depleted the soil and reduced food security.

Furthermore, colonial powers imposed taxes on the local population, which often led to economic hardships and social unrest. The imposition of taxes was often part of an effort to modernize the local population and create a more efficient system of governance.

Finally, colonial powers eroded native culture and identity through policies of assimilation and cultural domination. This created a legacy of inequality and instability that still affects many former colonies today.

Learn More about colonial powers :

https://brainly.com/question/14447948

#SPJ4

What can you tell me about the context and the style of Repos d'amour?

Answers

"Repos d'amour" is a painting by the French Rococo artist Jean-Honoré Fragonard, created around 1771-1773. The painting depicts a young couple resting in a landscape, surrounded by lush vegetation and flowers.

In terms of style, "Repos d'amour" is a quintessential example of the Rococo style. Rococo is characterized by its ornate and playful decorations, as well as its light and delicate brushwork.

The style emerged in France in the early 18th century, and was associated with the French court and aristocracy.

"Repos d'amour" is notable for its use of pastel colors and soft brushwork, which create a dreamy and romantic atmosphere.

The landscape is depicted in a hazy and almost abstract manner, with the emphasis placed on the couple in the foreground.

The woman is shown lying on her back, with her head resting on her lover's lap, while he leans over her and gazes down at her.

In terms of context, "Repos d'amour" was created during a time of great political and social upheaval in France. The painting was created just a few years before the French Revolution, which would overthrow the French monarchy and transform French society.

The Rococo style, which had been associated with the French court and aristocracy, would fall out of favor during the Revolution, as the new regime favored a more austere and classical style.

Despite this, "Repos d'amour" remains a beloved example of the Rococo style, and continues to be admired for its beauty and charm.

to know more about French Rococo refer here:

https://brainly.com/question/28260986#

#SPJ11

In two sentences, explain why people support and oppose new voting rules that some state legislatures have made in the United States.

Thank you!! :)

Answers

People support new voting rules because they believe that they will help to prevent fraud and ensure the integrity of elections.

Opponents argue that these rules are unnecessary and are designed to make it harder for certain groups, such as people of color and low-income individuals, to vote.

even in the north which group was a regular part of commerce linking north american, africa, and europe? group of answer choices skilled craftsmen and shopkeepers sons of wealthy gentry university-trained puritans slaves and indentured servants

Answers

The group that played a regular part in commerce linking North America, Africa, and Europe, even in the North, was the "slaves and indentured servants." The correct option is slaves and indentured servants.

This group was an essential component of the transatlantic trade system known as the Triangular Trade. This system involved the trade of goods, raw materials, and people among the three continents. The main components of the Triangular Trade were the exchange of manufactured goods from Europe for enslaved people from Africa, who were then transported to North America and the Caribbean.

Though slavery and indentured servitude were more prevalent in the Southern regions of North America, they were still present in the North, contributing to the commercial success of the region. The Triangular Trade enabled merchants in the North to profit from the sale of goods and raw materials, fostering economic growth and development.

In summary, slaves and indentured servants played a significant role in commerce that linked North America, Africa, and Europe, even in the northern regions. They were an essential part of the Triangular Trade system, which facilitated economic growth and prosperity throughout the colonies. The correct option is slaves and indentured servants.

For more about indentured servants:

https://brainly.com/question/4850869

#SPJ11

Describe some ways in which the Taliban soldiers destroy Kabul

Answers

The Taliban soldiers destroy Kabul by swarming the dilapidated Kabul museum and smashed pre-Islamic statues to rubble.

The Taliban, which also calls itself the Islamic Emirate of Afghanistan due to the name of its country, is a radical political movement of Deobandi Islamic fundamentalism and Pashtun nationalism in Afghanistan. He ruled three-quarters of the country from 1996 to 2001 before being overthrown after the US invasion. He recaptured Kabul on August 15, 2021, after nearly 20 years of insurgency, and currently controls the entire country, although his government is not recognized by any country. The Taliban government has been criticized for restricting women's and girls' human rights, including their right to work and education, in Afghanistan.

To know more about Taliban click on the link below.

brainly.com/question/12326725

#SPJ4

After winning their national independence, many countries subsequently sought to break their dependence on foreign imports and increase the range of commodities manufactured domestically. This policy is commonly referred to as:

Answers

The policy commonly referred to as breaking dependence on foreign imports and increasing domestic manufacturing is known as import substitution industrialization (ISI).

The idea behind ISI was that by producing goods domestically, these countries could reduce their reliance on foreign imports and promote economic development and self-sufficiency. ISI involved implementing protectionist policies, such as tariffs and quotas, to limit imports and encourage domestic production. Governments also provided subsidies and other incentives to support the development of domestic industries. While ISI did lead to some successes in terms of industrialization and economic growth, it also had some drawbacks.

For example, protected industries often became inefficient and uncompetitive, and consumers had limited access to imported goods. Overall, ISI was a strategy that aimed to promote economic development and reduce dependence on foreign imports. While it had some limitations, it played a significant role in the economic policies of many newly independent countries.

Learn more about import substitution industrialization here:

https://brainly.com/question/30243911

#SPJ11

how did the erie canal affect the american industrial revolution?

Answers

Answer: helped facilitate access to coal reserves in Pennsylvania, reducing American dependence on imported coal

Explanation:

Where did the Germans mostly immigrate in the American colonies?

Answers

Answer:The central colonies

Explanation:the greatest part of this immigration, especially Pennsylvania. As many as half of these immigrants came as redemptioners, that is, they agreed to work in America for four to seven years in exchange for free passage across the Atlantic.

Why was the early Chinese writing important for the Chinese

Answers

The early Chinese writing system was important for the Chinese because it was the foundation of their culture and communication.

What is culture ?

Culture is the practices, beliefs, values, and behaviors that make up the unique identity of a group of people. It is the way of life shared by a particular society or population, and can include language, customs, values, norms, and traditions. Culture shapes how people interact with one another and the world around them, and it is constantly evolving and adapting in response to changes in the environment. It involves everything from the way people dress and speak, to their diets and religious beliefs. It also includes ideas, stories, and art that are created and shared by the members of the culture. Ultimately, culture is the collective identity of a group of people and is an important part of human experience.

To learn more about culture

https://brainly.com/question/29285761

#SPJ1

Answer: early Chinese writing was essential for the preservation of culture, communication, governance, and the development of a shared cultural identity

Explanation:

What provision did New York City make for its homeless in the early 1870s?

Answers

In the early 1870s, New York City made provisions for its homeless population by establishing temporary shelters and aid programs. These provisions aimed to provide basic necessities like food, clothing, and a place to sleep for the city's homeless individuals.
In response to the growing homeless population, New York City opened up shelters, also known as "lodging houses," to provide temporary housing for those in need. These lodging houses were often supported by philanthropic organizations and religious institutions that provided funding and resources to help the city's homeless population.

In addition to lodging houses, aid programs were established to offer food and clothing to homeless individuals. "Soup kitchens" and charitable organizations distributed essential items to those in need.
Job placement services were also created to help homeless individuals find employment and eventually transition to stable housing.
In summary, New York City made several provisions for its homeless population in the early 1870s, including establishing temporary shelters, aid programs for food and clothing, and job placement services. These measures aimed to alleviate the struggles the city's homeless individuals faced and help them regain stability in their lives.

To learn more about homelessness, visit: https://brainly.com/question/31607626

#SPJ11

during the immediate postwar years, native americans group of answer choices saw themselves as rival members of independent nations. became equal partners in western settlement. refused to see themselves as conquered peoples. never ceded land in exchange for goods.

Answers

During the immediate postwar years, Native Americans refused to see themselves as conquered peoples and instead saw themselves as rival members of independent nations. The correct option is refused to see themselves as conquered peoples.

They recognized that they had been colonized and mistreated by the United States government, but they did not want to be seen as subordinate to them. Instead, they wanted to assert their own sovereignty and independence, and they saw themselves as equal partners in the western settlement. Native Americans never ceded land in exchange for goods, as they believed that their land was sacred and belonged to them.

They also resisted attempts by the government to assimilate them into white culture, and instead fought to preserve their own traditions and way of life. Despite facing many challenges and obstacles, Native Americans continued to resist colonialism and assert their own rights and autonomy, paving the way for future generations to fight for their own sovereignty and independence. The correct option is refused to see themselves as conquered peoples.

For more about independent nations:

https://brainly.com/question/2139879

#SPJ11

All of the following were important patrons of Dutch seventeenth century art EXCEPTA. popesB. guildsC. private individualsD. civic organizations

Answers

Popes did not play a significant role in the patronage of Dutch seventeenth-century art, as the Netherlands was a Protestant country and there was little contact between the Dutch artists and the papacy. The correct option is A.

The Dutch Golden Age, a period of economic and cultural prosperity in the Netherlands during the seventeenth century, saw a flourishing of artistic production, particularly in painting.

During this time, many patrons played an important role in supporting artists and commissioning artworks.

Among the most prominent were private individuals, who were often wealthy merchants, nobles, or members of the bourgeoisie.

They commissioned paintings for their homes or as gifts, and their tastes and preferences helped shape the direction of Dutch art.

Guilds, and associations of craftsmen, also played a significant role, commissioning artworks for their headquarters and sponsoring competitions and exhibitions.

Civic organizations such as city governments, churches, and hospitals were also important patrons of art, commissioning works for public spaces or as part of religious or civic ceremonies.

to know more about Patronage of Dutch refer here:

https://brainly.com/question/12881231#

#SPJ11

For the following books and concepts, name the author and say how it contributed to pessimism: (Psychoanalysis)

Answers

Psychoanalysis is a psychological theory and therapy developed by Sigmund Freud in the late 19th and early 20th centuries. While psychoanalysis itself may not have contributed to pessimism, some of its ideas and implications have been seen as pessimistic.

Freud's theories emphasized the role of the unconscious mind and the ways in which unresolved childhood conflicts and repressed memories can shape adult behavior.

He also introduced the concept of the "death drive," which suggests that humans have an inherent desire for self-destruction and an inability to ever achieve true happiness.

These ideas have been interpreted as pessimistic because they challenge the notion of free will and suggest that humans are inherently flawed and incapable of ever fully understanding or controlling their own minds.

Additionally, Freud's focus on the negative aspects of human experience, such as anxiety, guilt, and repression, can be seen as emphasizing the darker side of human nature.

To know more about Psychoanalysis refer here

https://brainly.com/question/29869553#

#SPJ11

THIS IS an antisense ATGCGGAATTGGCGACATAA , Write the nucleotide sequence that would be translated from this strand of DNA?

Answers

The nucleotide sequence that would be translated from this strand of DNA is ATCGCTTAGAACCGCATTCTT.

Nucleotide sequence is a string of nucleotides, which are the basic units of genes and genetic information. Nucleotides are made up of three parts: a phosphate group, a sugar molecule (deoxyribose), and a nitrogenous base.

The nitrogenous bases come in four different types—adenine (A), guanine (G), cytosine (C), and thymine (T). Every gene consists of an ordered sequence of these four bases. Different sequences of these compositions determine the physical characteristics expressed by an organism.

To know more about nucleotide sequence visit:

https://brainly.com/question/17105264

#SPJ4

What did King Louis XVI of France offer the Americas?

Answers

King Louis XVI of France offered: significant financial and military support to the Americas during the American Revolutionary War.

In response to your question about what King Louis XVI of France offered the Americas, the key terms to consider are King Louis XVI, France, financial support, military support, and American Revolutionary War.

King Louis XVI saw an opportunity to weaken Britain, a rival nation, by assisting the American colonies in their struggle for independence. After the American victory at the Battle of Saratoga in 1777, France entered into a formal alliance with the Americans.

This alliance, known as the Treaty of Alliance, provided the colonists with vital financial support, as France loaned money and supplied weapons, ammunition, and uniforms to the American forces.

Additionally, France offered military support in the form of troops, ships, and experienced officers. One notable figure who served as a volunteer was the Marquis de Lafayette, who played a crucial role in the war as a key aide to General George Washington.

French naval forces, under the command of Admiral de Grasse, also played a decisive role in the American victory at the Battle of Yorktown in 1781.

In summary, King Louis XVI of France offered financial and military support to the Americas during the American Revolutionary War. This support was essential in helping the colonists achieve victory and ultimately secure their independence from Britain.

To know more about Revolutionary War, refer here:

brainly.com/question/22135298#

#SPJ11

why were many abolitionist groups an extension of the church

Answers

The reason why many abolitionist groups serves as an extension of the church was that some of the Enlightenment philosophers opposed slavery and most of them are Christian activists.

What was abolitionist groups?

The groups can be described as the  fragmented anti-slavery movement  which were been set up so they can come against the act of slavery they some of the group which can be seen as  the Liberty Party; the American as wellas the Foreign Anti-Slavery Society.

Itshould be noted that the American Missionary Association as wellas other group rised up so that they can come against this and some of them are Christian activists.

Learn more about abolitionist at:

https://brainly.com/question/1818846

#SPJ1

About how long did the Portuguese trading empire in the Indian Ocean flourish?

Answers

The  Portuguese trading empire in the Indian Ocean flourishes in Less than a century.

The option (B) is correct.

Portugal's motivation in the Indian Sea was to guarantee the imposing business model of the zest exchange. Exploiting the contentions that set Hindus in opposition to Muslims, the Portuguese laid out a few fortresses and general stores. By 1600, the Portuguese general store realm started by Vasco da Gama in 1497 was at that point in steep downfall.

The Indian Ocean was the focal point of world exchange. A wide range of shipping lanes crossed its waves. These courses connected the South China Ocean to the Indian Sea to the Mediterranean Ocean.

Learn more about trading empire:

https://brainly.com/question/2574969

#SPJ4

This question is not complete, Here I am attaching the complete question:

About how long did the Portuguese trading empire in the Indian Ocean flourish?

a) Nearly four centuries

b) Less than a century

c) Less than 50 years

d) About two centuries

How and why did employer-employee relationships change during the Industrial Revolution?

Answers

Relationships change during the Industrial Revolution as foundation of huge plants obliterated those immediate connections, offering proprietors less chance to lay out an individual interest in laborers.

The Industrial Revolution changed economies that had been founded on horticulture and handiwork into economies in view of enormous scope industry, motorized assembling, and the manufacturing plant framework. Existing industries were made more productive and efficient by new machines, new power sources, and new ways to organize work. Opportunities for employment increased as a result of the Industrial Revolution.

Compared to what farmers were earning, factory wages were higher. As factories spread, more managers and workers were needed to run them, which led to an increase in the number of jobs available and overall wages.

Learn more about Industrial revolution :

brainly.com/question/13323062

#SPJ4

Give a definition or explanation of greenstone belts and include the age of the oldestknown greenstone (or supracrustal) belt.

Answers

Greenstone belts refer to geological formations that consist of primarily volcanic rocks and sedimentary rocks that have undergone intense metamorphism.  The Isua Greenstone Belt is the oldest known greenstone belt, dating back approximately 3.8 billion years.

These belts are typically found in Archean and Proterozoic rock sequences, and they are believed to have formed during periods of active tectonic activity and volcanic eruptions.

Greenstone belts are important as they often host economically significant mineral deposits, such as gold, silver, and copper. These belts also provide valuable insight into the early evolution of the Earth's crust and the processes that led to the formation of continents.

The oldest known greenstone belt is the Isua Greenstone Belt in southwest Greenland, which has been dated to be approximately 3.8 billion years old. This belt is believed to have formed during the early stages of the Earth's formation and provides important clues about the conditions that existed on the planet during that time.

In summary, greenstone belts are geological formations composed of primarily volcanic and sedimentary rocks that provide valuable insights into the early evolution of the Earth's crust and host economically significant mineral deposits. The Isua Greenstone Belt is the oldest known greenstone belt, dating back approximately 3.8 billion years.

For more about Greenstone belts:

https://brainly.com/question/31322244

#SPJ11

in 1890, the sherman anti-trust act was enacted. what was it's purpose, and how did it effect organized labor?

Answers

In 1890, the Sherman Anti-Trust Act was enacted. Its primary purpose was to regulate and prevent monopolistic practices by large corporations, as well as to promote economic competition. This legislation aimed to prohibit trusts, cartels, and other business arrangements that could potentially hinder fair competition within the marketplace.

The impact of the Sherman Anti-Trust Act on organized labor was significant. Initially, the Act was not only used to target big corporations, but it was also applied to labor unions. Courts often viewed unions as potential restraints on trade, as they could limit the supply of labor and drive up wages.

Consequently, unions were sometimes prosecuted under the Act, which led to the weakening of the labor movement during this period.

However, as the interpretation of the Sherman Anti-Trust Act evolved over time, its application to labor unions diminished. In 1914, the Clayton Antitrust Act was passed, which explicitly exempted labor unions from being considered as monopolies or illegal combinations.

This allowed organized labor to regain strength and continue advocating for better working conditions and wages for their members.

In conclusion, the Sherman Anti-Trust Act of 1890 was enacted to prevent monopolistic practices and promote competition. Initially, its impact on organized labor was negative, as unions were prosecuted under the Act.

However, with the passage of the Clayton Antitrust Act in 1914, unions were exempted from the law, allowing them to continue fighting for workers' rights.

To know more about monopolistic practices refer here

brainly.com/question/12652861#

#SPJ11

Other Questions
With their ice cream firm, Ben and Jerry sought to foster a culture of religious tolerance. be a concerned and responsive employer. pay top management and the owners many multiples of the lowest-level worker's pay. support religious values by holding frequent prayer meetings. An accidental path of low resistance bypassing the intended path and allowing passage of an abnormally high amount of current is known as what?a) open circuitb) short circuitc) polarized groundd) ground reference point Frequency 6 5 4 3 IL 2 - 1 Height (inches) 50 55 60 65 70 75 80 The histogram shows the heights of students in a class. Answer the following questions: (a) How many students were surveyed? Activate Go to Sett (b) What percentage of students are taller than or equal to 50 inches but less than 60 inches? Receiver FSM in RDT over Reliable Channel With Bit Errors (RDT 2.0) How many kingdoms are there in the domain Bacteria?OA. 3OB.AOC. 2OD. 4 when a country experiences capital flight, which of the following rise? question 11 options: its real interest rate and its real exchange rate its real interest rate but not its real exchange rate its real exchange rate but not its real interest rate neither its real interest rate nor its foreign exchange rate public static String changeStr(String str){String result = "";for (int i = str.length() - 1; i >= str.length() / 2; i -= 2){result += str.substring(i, i + 1);}return result;}What value is returned as a result of the method call changeStr("12345") ? if a project you are evaluating is riskier than average for your company, should you use wacc as your discount rate, adjust wacc up, or adjust wacc down? group of answer choices marketing strategies can be used to shape demand in all ways, except: a. modify mode of delivery. b. use price and other cost. c. change product elements. d. use promotion How many antibodies do B lymphocytes produce? 55 Points! Multiple choice algebra question. Photo attached. Thank you! if a country signs a trade agreement so that employment in some industries rises and employment in some industries fall, then a. structural unemployment rises permananently. b. frictional unemployment rises temporarily. c. frictional unemployment rises permanently. d. structual unemployment rises temporarily. explain the quote in your own words in about 150 words "povertyis looking into a black future" Suppose improvement in technology is expected to increase the future marginal product of capital. Holding output constant, what would be the effect on the goods market and on the IS curve?A.National savings decreases leading to a higher interest rate that clears the good market. IS shifts up and to the rightB.National savings increases leading to a lower interest rate that clears the goods market. IS shifts down and to the left.C.National investment increases leading to a higher interest rate that clears the goods market. IS shifts up and to the right.D.National investment decreases leading to a lower interest rate that clears the goods market. IS shifts down and to the left. How does Lee Coker respond to Amos Hicks and his criticism of Janie? progression through the cell cycle requires a cyclin to bind to a cdk because a. the cyclins are the molecules with the enzymatic activity in the complex. b. the binding of a cyclin to cdk is required for cdk enzymatic activity. c. cyclin binding inhibits cdk activity until the appropriate time in the cell cycle. d. without cyclin binding, a cell-cycle checkpoint will be activated. what syntax would a vim user choose if they wanted to perform a search-and-replace operation on an entire document? an object repels the plastic rod. what will it do to the glass rod? match the words in the left column to the appropriate blanks in the sentences on the right. The heights of people in a certain population are normally distributed with a mean of 64 inches and a standard deviation of 3.1 inches. Determine the sampling distribution of the mean for samples of size 39. What is the mode of the following distribution of scores: 2, 2, 4, 4, 4, 14?-6-5-4-2