Describe the different services that state, county, and local governments provide their citizens. Explain why different levels of government are necessary.

Answers

Answer 1

Answer:

people expect state and local governments to provide services such as police protection, education, highway building and maintenance, welfare programs, and hospital and health care. Taxes are a major source of income to pay for these services and many others that hit close to home

Explanation:

Answer 2

The different services that states, local and federal government can give to their citizens are

educational servicessocial serviceshealth servicesemployment

Why the different levels of government are necessary?

The different levels of government are necessary for the provision of services and the raising of tax in the nation.

The levels of government are responsible for the provision of need at all the levels of the government.

Read more on government here: https://brainly.com/question/853069


Related Questions

1. TRUE or FALSE: Tensions between Israeli's and Palestinians still exist today?
True
False

Answers

Answer:

The Israeli-Palestinian conflict dates back to the end of the nineteenth century. Tensions also remain high between the Israeli military and Hamas. In a response to the ICC due today, Israel will reject allegations against it and assert

Explanation:

hope this helps:)

How did Stonewall Jackson’s military career end?

Answers

Answer:

Jackson lost an arm and died after he was accidentally shot by Confederate troops at the Battle of Chancellorsville

Explanation:

Hope this helped!!!!

What the status of the Paris Peace talks when Nixon took office?​

Answers

Answer:

The Paris Peace Accords, officially titled the Agreement on Ending the War and Restoring Peace in Viet Nam was a peace treaty signed on January 27, 1973, to establish peace in Vietnam and end the Vietnam War.

what is the ring ,what does it mean???????

Answers

Answer:

a small circular band, typically of precious metal and often set with one or more gemstones, worn on a finger as an ornament or a token of marriage, engagement, or authority.

Explanation:

STAR WARS FANS OF OLD (REPUBLIC) AND FANS OF NEW (FIRST ORDER) UNITE. STAR WARS FOREVERRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR

Answers

Answer:

cool

Explanation:

Lightsaber: activates

Which of the following is stated in the
"Two Treatises of Government" by
John Locke?
A. Absolute power through divine right should not be a
form of government.
B. People abuse power and cannot be trusted.
C. People need a social contract with their absolute
ruler.

Answers

Answer:

A

Explanation:

'Absolute power through divine right should not be a form of government was stated in the "Two Treatises of Government" by John Locke. Thus, option 'A' is the correct option.

What were the  "Two Treatises of Government" by John Locke?

The Two Treatises of Government by John Locke were released under a pseudonym in 1689. As the thesis of what is now known as social contract theory, Locke suggested that government arises from the consent of the government to safeguard their basic rights. The main text of English philosopher John Locke's political theory, Two Treatises of Government, was published in 1689 but was mostly written earlier.

These natural rights are made up of three fundamental parts: the right to life, the right to liberty, and the right to property. According to Locke, the right to life ensures that each individual essentially "owns" himself. Locke also attempted to disprove Sir Robert Filmer's pro-Absolutist beliefs, which he and his Whig friends believed were becoming far too popular.

Learn more about "Two Treatises of Government", here:

https://brainly.com/question/10134272

#SPJ2

1. Describe in detail two reasons or policies that led America to enter the war in Vietnam.
2. In your opinion, was America's entering the war in Vietnam justified? Why or why not? Provide details from the unit to support your opinion.
3. The war on terror has been considered the new Vietnam War because continued for nearly 20 years. Do you think that this war will ever end? Why or why not?

Answers

Answer:

Read the Answer I wrote

Explanation:

1: America was afraid of the domino effect were all of asia could fall under communism so they had to contain the spread of communism

2: In my opinion yes because Communism could have easily spread to India, Iran, Iraq, and much further had south east asia fallen under Communism

3: I think this war will end as this time the U.S has a tactic, they fight like they fought in the old wars, For example, in desert storm they fought like Vietnam, in Vietnam they fought like the Korean war, in the Korean war, they fought like WW2.

What were the two main factions in the Chinese Civil War in the twentieth century?

A. the Communist Party–led government and Fascist Party

B. the Socialist Party–led government and the Nationalist Party

C. the Fascist Party–led government and the Socialist Party

D. the Nationalist Party–led government and the Communist Party

Answers

Answer:

D.

Explanation:

The Nationalist Party and the Communist party where the two parties fighting for power before and after WW2. The Communist Party was headed by Mao Zedong and the Nationalists where led by Chang Kai-shek.


How did Gompers and his American Federation of Labor try to improve conditions for workers?

Answers

Answer:

He was a diehard capitalist and saw no need for a radical restructuring of America. Gompers quickly learned that the issues that workers cared about most deeply were personal. They wanted higher wages and better working conditions. These "bread and butter" issues would always unite the labor class.

Explanation:

100 points
In early villages, most citizens
A were engaged in agriculture
B were merchants who engaged in trade
C. were hunters and gatherers
D worked as craftsmen
Please select the best answer from the choices provided.
B
оооо
D
Save and Exit
Next
Submit
Mark this and return

Answers

Answer:

C. were hunters and gatherers

Explanation:

Answer:

In early villages, most citizens were hunters and gatherers.

Explanation:

Germany did not want a two front war, but got one. Which two countries did Germany fight? A.)Austria-Hungary and Russia
B.)Sweden and Russia
C.)Portugal and France
D.)Russia and France

Answers

Answer:

The Answer is either C or D

Explanation:

What are the implications of swearing an oath to an individual leader, rather than to a nation?

Answers

Answer:

German military recruits swear allegiance to Adolf Hitler.

limitations to the rights and freedoms of citizens

Answers

Answer:

The answer is below

Explanation:

In the United States, Limitations to the rights and freedoms of citizens are only permissible under some specific circumstances, such as:

1. If and when provided by law

2. If and when necessary for respect of the rights or reputations of others

3. If and when necessary for the protection of national security and public order

4. If and when necessary for public health or morals.

What is considered the most important event turning point of WW II in the pacific and why

Answers

the battle of midway because it was the first significant battle that led to a victory for the united states navy and let down all hopes of victory to neutralize the pacific for the japanese

How did the early events of World War II impact US isolationism and help pave the road to war? (Lesson 5.8)

Answers

Answer:

how the world war 2 impacted the USA america’s invlove meant in World War 2 had a signfgiant impact on the economy and workforce of the United State. American factories were retooled to produce goods to support the war effort and almost overnight the unemployment rate dropped to around 10%.

Explanation:

Sorry I couldn’t answer the rest of you question and if this isn’t what your looking for sorry.

The early events of World War II had a significant impact on US isolationism and played a role in paving the road to war. Prior to the war, the United States maintained a policy of neutrality and sought to avoid direct involvement in the conflict.

However, events such as the German invasion of Poland, the fall of France, and the bombing of Pearl Harbor shattered American isolationist sentiments.

These events demonstrated the growing threat posed by aggressive expansionist powers and the vulnerability of the United States itself. They stirred public outrage and led to a shift in public opinion towards interventionism, ultimately pushing the United States towards active participation in the war.

Learn more about US isolationism:

https://brainly.com/question/26978592

#SPJ2

Is a worm an example of an inorganic or organic component of soil? Inorganic Organic or inorganic​

Answers

Answer:

A worm is an example of an organic component of soil, this is because it goes through life processes. It functions as part of the food chain as a decomposer.  

Explanation:

Answer:

A worm is a organic component of soil.

for the reason is that it breaks down Orangic matter and this process most likely to help plants to obtain nutrients.

How did the Italian economy affect the development of art during the Renaissance?

Answers

Answer:

As trade increased ideas in trade grew and goods increased. The three most important causes of the Renaissance was the rise of cities, increase in education, and the realization of how corrupt the church was.

Explanation:

hope it helps

why might a county nationalize certain industries​

Answers

Answer:

Nationalization often happens in developing countries and can reflect a nation's desire to control assets or to assert its dominance over foreign-owned industries. Often, the companies or assets are taken over and little to no compensation is provided to the previous owners.

Explanation:

2. The "Free World" is the same as:
O A. the West
B. the East
O C. the nonaligned nations

Answers

The “free world” is the same as B

Ie: Soviet Union, other communist countries

Which statement best describes how horses affected American Indians of the Great Plains?

A. Horses provided hides for tepees
B. Horses became a symbol of religious worship
C. Horses improved the way Great Plains tribes hunted
D. Horses became valuable in trade for Great Plains tribes​

Answers

Answer: C

Explanation:

Got it right :) how’s you’re day

Question 1
How was Adoph Korn abducted?
hit over the head with a gun
beaten up
tied up and dragged off

Answers

Answer:

he got hit on the head with a gun

Explanation:

Answer:

Hit over the head with a gun

Explanation:

I believe that this is correct.

Why was the reservation system created in the 1850's?

A) to settle a border dispute with Canada

B) to confide American Indian tribes to specific areas

C) to give white settlers room to build farms

D) to help spread Christianity to America Indian tribes

E) to avoid war between settlers and American indians

Answers

Answer:

b. to confide American Indian tribes to specific areas.

Answer:

B, C, and E.

Explanation:

Plz help!
What reasons does Truman give for wanting to push back against communist expansion?

Answers

Answer:

In 1947, President Harry S. Truman pledged that the United States would help any nation resist communism in order to prevent its spread. His policy of containment is known as the Truman Doctrine. .To help rebuild after the war, the United States pledged $13 billion of aid to Europe in the Marshall Plan He argued that a Communist victory in the Greek Civil War would endanger the political stability of Turkey, which would undermine the political stability of the Middle East. This could not be allowed in light of the region's immense strategic importance to U.S. national security.

.have a good day/night may i please have a branlliest

Explanation:

Which of the following best describes the "cause for which they gave the last full
measure of devotion"?
A) Economic independence
B) Preservation of the Union
C) Strength of the military
D) Political revolution

Answers

C)Strength of the military

A wind turbine is most like a _______________
A; windmill
B; windsock
Please I need it for my test :(

Answers

A) windmill

Hope you do good on your test! :)

Answer: Windmill because Windmill also need wind and wind turbine also need wind

Please mark me brainliest

HOPE THIS HELPS

Select the correct answer.
What happens If you fail to pay your annual taxes?
• A.
you will simply have to pay some penalty fees
B. you can file your return the next year
C. you will have to pay
penalty fees or face imprisonment, depending on the severity of nonpayment
D.
you will have to pay twice the amount of taxes the next year
Reset
Next

Answers

Answer:

A it's the answer, and depending the length of the failure to pay the taxes, will the determine late fee penalty plus interest.

The answer is either A or C

1. What role does government play in capitalism?

Answers

Answer:In a capitalist economy, the role of government is very limited. The main functions of government, as given by Adam Smith, are to maintain law and order in a country, make national defense stronger, and regulate money supply. According to Smith, the market system administers various economic functions.

the American genocide is an example of
a. diplomacy
b. a government using war as an excuse to commit atrocities on its own citizens
c. communist revolution
d. self determination

Answers

Answer:

B. A government using war as an excuse to commit atrocities on its own citizens.

Explanation:

I believe its this, but do you mean or armenian, because that might change the answer.

Why are containers important to the shipping industry? What effect do they have?

Answers

They are important because it’s a great way for transporting goods. They brings lots of materials. Since they can vary is size and shape, and carrying capacity, many liner ships are able to transport up to 8K containers of goods and products!
they are important because that are Easy way to transport big goods.

Why were teddy bears popular with adult women during prohibition?

Answers

Answer:

Explanation: During Prohibition, the primary source of drinking alcohol was industrial alcohol – the kind used for making ink, perfumes and campstove fuel. The next most common source of alcohol in Prohibition was alcohol cooked up in illegal stills, producing what came to be called moonshine.

Other Questions
A steel bottle contains nitrogen gas at STP. What is the final pressure if the temperature is changed to 155C? Calculate the number of moles in 40g of Al(OH)3 a example of metaphor and explain the metaphor Write a scientific explanation as to What is the main cause of global warming?" What is the relationship between Nike with the Second Industrial Revolution? Which expression is equivalent to 7x(yz - 7 - 2y) A 9-inch diameter pizza has 30 calories per square inch. About how many calories are in the entire pizza?Use 3.14 for pi. Amelia is using substitution to determine if 8 is a solution to the equation. Complete the statements. 6a = 42 for a = 8 First, Amelia must substitute 8 for the using To simplify, Amelia must 8 a solution of the equation. pls hurry I'm on timer what were the social achievements of rana regime? HELP ME PLS! ASAP 10 POINTS FOR THIS ONE & THE NEXT ONE!!!!!! can someone please help me What was Kristallnacht? a. an attack on Jewish homes, businesses, and synagogues in Germany b. a ship full of Jewish refugees denied entry in the United States c. a set of laws denying Jews of their German citizenship, jobs, and property d. a group of highly educated Jewish refugees allowed into the United States Find the circumference and area of a circle A with a diameter of 26 inches. Please I need the answer ASAP. Thank you very much. where did Jewish immigrants to South africa come from what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? Did I do this right? if I didn't get it right can you help me? Thank you! Determine which number is a solution to the inequality. These four numbers are plotted on a number line:-23,58,-35,-12Which is the correct ordering on the number line, from left to right? A . -12,-35,-23,58 B. -12,-35,58,-23 C. -23,-35,-12,58 D. -35,-23,-12,58 Mahi has 31 rolls of string. Each roll holds 12 yards of string. How many feet of string does she have? can anyone tell me my mistakes pls?