Compare and contrast evaporation and condensation.

Answers

Answer 1

Answer:

By definition, evaporation is a process where water changes into vapour. Condensation is the opposite process where water vapour is converted to tiny droplets of water. Evaporation occurs before a liquid reaches its boiling point. Condensation is a phase change regardless of the temperature.


Related Questions

Birds display a wide variety of courtship behaviors. Which behavior is also a territorial behavior?(1 point)

creating a bower (arch) with interesting objects and defending it from rival males

flashing feathers to show their health and grooming abilities

dancing and calling on a lek (communal ground) with other males, competing for female attention

singing a particular song to help potential mates hear them

Answers

Answer:  The correct answer is "creating a bower (arch) with interesting objects and defending it from rival mates".

Explanation:

Just took the quiz.

creating a bower (arch) with interesting objects and defending it from rival males is a territorial behavior.

What is Territorial behavior?

Any defended area is referred to as a "territory," and most birds are territorial (in the sense that they defend some area, even if it's merely a nest site), at least for a portion of the year.

When a territory is defended, the "owner" has access to one or more resources (or access to resources of higher quality) than they otherwise would. According to what resource (or resources) is (are) being protected, territories can be categorized.

Type A territory, or the area where mating, nesting, and feeding take place (such as courtship, mating, nesting, & foraging).

Therefore, creating a bower (arch) with interesting objects and defending it from rival males is a territorial behavior.

To learn more about territory, refer to the link:

https://brainly.com/question/21152582

#SPJ2

The most common danger related to the destruction of CD4 T cells is

Answers

Answer:

AIDS

Explanation:

AIDS is the most common infectious disease causing lymphocytopenia, which arises from destruction of CD4+ T cells infected with HIV.

do all prostars become stars why or why not

Answers

Answer:

no everyone can get popular but they can reach it if they try hard enough

Explanation:

Answer:

Not all of them because the crown might not like the much so that why they don't become famous

Explanation:

Can you read this??


Dndkfrjjdfjjd

Answers

Answer:

I can't read the picture because it's too pixelated, but "Dndkfrjjdfjjd"

clearly means "Da National Day Known For ReJoicing Joe's Dad For Joyous Jiving Dogs".

When you are sitting in a bath, are your skin cells in a hypertonic or hypotonic solution?

Answers

Answer:

hypotonic

Explanation:

I really need helppp... I will thank you all my life.

Answers

Explanation:

Hope this helps!

The writing is small but readable!

*WILL MARK BRAINLIEST!!* and you don't have to answer all of them! :D

A.) The middle lamella _____.
1.)surrounds and protects the chloroplast
2.)stores water inside the plant cell
3.)attaches plant cells to one another
4.)captures sunlight for use in photosynthesis

B.)Organisms cannot make their own food without _____.
1.)cell membranes
2.)cell walls
3.)chloroplasts
4.)vacuoles

C.) Chloroplasts _____.

1.)provide structure and support for plant cells
2.)are also found in animal cells, but they are much smaller
3.)are found inside the mitochondria
4.)allows plants, algae, and certain bacteria to make their own food

D.) Vacuoles are important for _____.

1.) energy production
2.) protection
3.) storage
4.) photosynthesis

E.) Which of the following statements is true?

1.) The rigidity of a cell wall causes plants to be sedentary.
2.) Primary cell walls are more rigid than secondary cell walls.
3.) Since they have cell walls, plant cells do not have cell membranes.
4.) A wilting plant will have a full central vacuole.

F.) Choose all the answers that apply.
Which of the following are only found in plant cells?
1.) cell membranes
2.) chloroplasts
3.) cell walls
4.) vacuoles

Answers

F) chloroplast and cell wall

Answer:

A: 3.)attaches plant cells to one another

B: 3.)chloroplasts

C: 4.)allows plants, algae, and certain bacteria to make their own food

D: 3.) storage

E: 1.) The rigidity of a cell wall causes plants to be sedentary.

F: 2.) chloroplasts  and 3.) cell walls

Explanation:

I got a 100 on this assignment i know all of these answers are correct

PLEASE HELP!!!!!!!!!!!!!!!!!!!!

Which statement describes competition within a population?

Several killer whales migrate to a new location.
Two male sea horses fight to win over a female.
Several elk travel together to find and share water.
Different kinds of garden plants take in water from the soil.

Answers

Answer:

I think its B if I'm wrong I'm sorry

Two male sea horses fight to win over a female describes the competition within a population. So, the correct option is B.

What is Competition?

Competition is defined as an interaction between organisms or species in which both require a resource in limited supply that reduces the fitness of both organisms because the presence of one of the organisms always consumes the available resource which reduces the quantity.

Competition is defined as the fight between different organisms by limited resources. Some examples of interspecific competition between lions and leopards that vie for the same prey and interspecific competition between rice fields with weeds growing in the field, two male seahorses fighting to win over a female.

Thus, the correct option is B.

Learn more about Competition, here:

https://brainly.com/question/23571652

#SPJ3

What two systems are affected by the common cold and why

Answers

Answer: nose, throat, and sinuses

Explanation:

because its an infection of the upper respiratory system.

Genes A and B are neutral. A weakly beneficial mutation arises in the population. This mutation is 100 base pairs away from Gene A and 1000 base pairs away from Gene B. If this mutation were to go to fixation within the population, which gene would be more likely to go to fixation and what is the term for this process? Is there any reason to suspect that one or both of these genes may not go to fixation? Why or why not?

Answers

Answer:

Both genes would be likely to go to fixationThe term for this process is "linked genes"The reason to suspect that both of these genes may not go to fixation is that they are too close to the mutation and the recombination frequency between them is very very low.

Explanation:

Independent assortment law establishes that the alleles from two or more different genes distribute in gametes independently from each other. In other words, a gamete receives an allele from a gene that does not depend nor influence the allele of another gene in the same gamete. This can only be applied to independent genes. These genes segregate independently after crossing-over because they are located far away from each other.

Some other genes, however, are too close to each other and they do not segregate independently. These are the linked genes that do not exhibit an independent distribution, and they inherit together more frequently.  

Crossing-over between linked genes that are very close to each other in the chromosome is not that common. Crossing-over during meiosis occurs randomly in different positions all along the chromosome, and its occurrence frequency in the area between two genes depends on the distance between them. A short distance between genes is a very little target for crossing-over to occur, which means that only a few of them will happen, compared with the number of events between genes that are more separated between each other.  

Two genes that are very close will have a few recombination events and are strongly bounded.  

The more separated two genes are, the more chances of recombination there will be.  The closer they are, the fewer chances of recombination there will be.

Genes that express 50% of recombination frequency or more are not linked genes.  

To analyze the recombination frequency, we have to know that

1% of recombination = 1 map unit = 1centi Morgan = 1,000,000 base pairs.

And that the maximum recombination frequency is always 50%.  

The map unit is the distance between the pair of genes for which every 100 meiotic products one of them results in a recombinant one.  

In the exposed example we know that the distance of gene A from the mutation is 100 base pairs, and the distance of gene B from the mutation is 1000 base pairs.

1,000,000 base pairs ------------------ 1% recombination frequency

1000 base pairs -----------------------X = 0.001% recombination frequency

100 base pairs ------------------------ X = 0.0001% recombination frequency

According to the recombination frequency between the mutation and gene A, and between the mutation and gene B, we can assume that both genes are linked to the mutation, as they seem to be too close to it. They are so close, that their recombination frequency is very little.  

                                             

Describe the net movement of water when a dialysis bag containing a 0.2 M sucrose solution is placed into distilled water, which contains no solutes.

a. There will be no movement of water.
b. Water will move into the bag.
c. Water will move into the beaker.
d. There will be no net movement of water.

Answers

Answer:

b

Explanation:

The correct answer would be that water will move into the bag.

The 0.2 M sucrose solution in the dialysis bad has a lesser water potential when compared to the distilled water that has no solutes. By law, water moves from the region of higher water potential to the region of lower water potential. The dialysis bag will, hence, act as a semi-permeable membrane and allow water into the bad from the surrounding distilled water.

The correct option is b.

What is ozone?

I really need help guys!!!!

Answers

Answer:

It is a toxic unstable gas that is made up of 3 oxygen, or also known as O3, and can oxidize.It is formed from electrical charges or ultraviolet light.

Explanation:

Which compares the problems associated with radioactive waste created from generating electricity using fusion reactions to waste created from generating electricity using fission reactions?

A. The radioactive waste from fusion reactions becomes less hazardous much sooner than the waste from fission reactions.

B. The radioactive waste from fission reactions becomes less hazardous much sooner than the waste from fusion reactions.

C. Although their radioactive wastes are hazardous for the same period of time, fusion reactions produce less waste than fission reactions.

D. Although their radioactive wastes are hazardous for the same period of time, fission reactions produce less waste than fusion reactions.

Answers

Your answer is to your question is A

Radioactive waste from fusion reactions becomes less hazardous much sooner than waste from fission reactions, nuclear fusion is much safer than fission because it leaves no radioactive waste behind.

What is the difference between the two reactions?

Both processes are natural, but they can also be done in a laboratory. While fusion occurs when two atoms are "crushed" to form a single atom of a new element, fission consists of the splitting of an atomic nucleus.

With this information, we can conclude that Radioactive waste from fusion reactions becomes less hazardous much sooner than waste from fission reactions, nuclear fusion is much safer than fission because it leaves no radioactive waste behind.

Learn more about nuclear fusion in brainly.com/question/12701636

#SPJ2

Scientists use english units of measurement true or false

Answers

Answer:

Falus

Explanation:

ANSWER: True

explanation: scientist use metric units

Select the terms that fit in the science category "Earth and Space." Select all that apply. water air animals land plants solar system light sound

Answers

Answer:

water

air

animals

plants

solar system

light

Explanation:

Earth is one of the nine planets and it is the one known to host human life. Earth is made up of the atmosphere which contains gases needed to sustain life. Water, air, animals, and plants can be found on the earth.

Space is a vacuum that hosts the galaxies and sun which make up the solar system. The Sun emits light which can be reflected on the earth as the planets revolve around the sun.  

How do scientists say the melting ice can contribute to disease occurrence? Also example

Answers

Answer:

In the melting of icebergs, icebergs could potentially contain long-dormant bacteria and viruses. Those viruses trapped in ice and permafrost for centuries, can be reactivated. That means melting those ice could potentially open a Pandora's box of diseases.  Including some that have caused global epidemics in the distant past.

Example: babesiosis

As of regular ice. The freezing of bacteria in water isn't just an old practice and ice from unclean sources could also contain disease, when melted and ingested or touched this ice as well could transmit disease not so long-dormant, however still unpleasant.

Example: AIDS

Why does the amount of energy available change as you move from one
trophic level to the next? Does this process still follow the Law of
Conservation of Energy? Explain your reasoning.

Answers

Answer:

hope it helps you

Explanation:

Energy decreases as it moves up trophic levels because energy is lost as metabolic heat when the organisms from one trophic level are consumed by organisms from the next level. Trophic level transfer efficiency (TLTE) measures the amount of energy that is transferred between trophic levels.

Ozone blocks ____ radiation but greenhouse gasses trap _____ radiation.

Answers

Answer:

Ozone blocks ultraviolet radiation but greenhouse gasses trap infrared radiation.

Why does the Ocean appear to be blue?

A, because all light that reach the the ocean's surface is blue light

B, As light travels through the ocean, red and orange light gets absorbed first while blue light
continues to travel deeper, make the ocean appear to be blue

C, As light travels through the ocean, blue light gets absorbed first, which makes the ocean appear to be blue

D, The surface of the seafloor is blue

Help please

Answers

I do believe the answer is B

Answer:

its because the sky is blue and it reflects to the ocean

What type of radiation constitutes the basis for setting an SPF rating?

p

Answers

Answer:UV radiation

Explanation:



2. Which of the following does NOT contribute to globalization?
a) Countries protect their trade positions by increasing tariffs on foreign imports
b) Technological advances allow for decreased communications costs
c) Containerization makes international shipping inexpensive
d) Countries ratify new free trade agreements​

Answers

C) containerization makes international shipping expensive

during photosynthesis,what role is played by the radiant energy of the sun ?

Answers

Answer:

the energy of the sun is the ATP or energy that will react with water and carbon dioxide which will make sugar and oxygen.

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Answers

GTTCAAGCTACTGTTCAAGCTACT

We covered transcription and translation in our lab this week. Below, you'll find several steps required for protein synthesis. However, they're not in the conted
order. Copy and paste these steps into your own post. Then place the steps in the correct order with the first step at the top of the list and the last step at the
bottom of the list
• mRNA connects with a ribosome
• mRNA is built based on the DNA template
• mRNA leaves the nucleus
• The 2 strands of DNA separate
The entire mRNA strand is translated into amino acids and a polypeptide is formed
• The mRNA + attached tRNA shifts, moving the tRNA from the A site to the P site
• RNA brings an amino acid into the A site
• RNA brings an amino acid into the P site
• tRNA leaves the P site and a peptide bond is formed between the amino acids

Answers

Answer:

The correct answer is :

The 2 strands of DNA separatemRNA is built based on the DNA templatemRNA leaves the nucleustRNA brings an amino acid into the P site. tRNA brings an amino acid into the A site. tRNA leaves the P site and a peptide bond is formed between the amino acids. The mRNA+attached tRNA shifts, moving the 6-tRNA from A site to the P site. The entire mRNA strand is translated into amino acids and a polypeptide is formed.

Explanation:

Protein synthesis is a process that is made up of two distinct processes namely transcription and translation.

Transcription: this process include several steps where the segment of DNA which has information, copied into the new molecule called mRNA which acts as the template as it has information copied from the DNA to produce gene expression.

Translation: is the process includes several steps in which a peptide chain is formed from the mRNA with the help of tRNA and ribosomes.

The correct order of steps is given under the answer heading.

byun walked 15 blocks in 25 minutes what was his average speed

Answers

Answer:

[tex]\frac{3}{5}[/tex]blocks/minutes

Explanation:

Given parameters:

  Number of blocks walked  = 15blocks

  Time taken for the walk = 25minutes

Unknown:

Average speed  = ?

Solution:

In this scenario, the average speed is the rate of walking the blocks per unit of time;

  Average speed  = [tex]\frac{number of blocks}{time}[/tex]  

Input the parameters and solve;

  Average speed  = [tex]\frac{15}{25}[/tex]blocks/minutes

   Average speed  = [tex]\frac{3}{5}[/tex]blocks/minutes

Which molecule in Diagram 11 is used to transport energy to other parts of the plant?

Answers

Answer:

The answer is Sugars, or sugar molecules!

Explanation:

The sugar and other organic molecules are transported through the plant by means of a special layer of tissue called phloem. Phloem is composed of living cells that transport a water solution of sugars that we commonly call sap.

The  molecule is Sugar ,transported principally as Sucrose, but originally as Glucose after photosynthesis  and stored as starch in plants.

The sucrose is transported in the Phloem( one of the vascular tissues, the second is the xylem. They are located adjacent o each other.)The process of transportation is called, Pressure Flow Model. The process of moving the sugar through the plants is called Translocation.

There are two regions during transport of sugar in translocation. The source where the sugar is produced, that is the  green leaves, and the sink where the sugar is metabolized.

Therefore the high concentration of the sugar at the source([plant leaves) increases the solute potential of the cell in the phloem of the leaves. This set up a gradients that draw water from the adjacent  xylem into the phloem by osmosis.

The  water influx increases the pressure potential of the phloem sap, and which makes the phloem turgid. The creates turgor pressure because of the increases of the phloem sap (containing sugar).The pressure  leads to the bulk transport of the sap contain sugar (translocation) from the source( leaves) to the Sink.

At the sink, the sugar is withdraw . Thus the solute potential rises,(with a drop in pressure potential) and  water  return by osmosis back to the xylem for the process to continue with another transport.

More https://brainly.com/question/18518187

Which are characteristics of eukaryotic organisms? PLZ HELPP

Answers

Answer:

Eukaryotic cells are larger than prokaryotic cells and have a “true” nucleus, membrane-bound organelles, and rod-shaped chromosomes. The nucleus houses the cell's DNA and directs the synthesis of proteins and ribosomes.

Explanation:

What are the seven 7 levels of
classification?

Answers

Answer:

from largest to smallest the 7 levels of classification are: Kingdom, Phylum, Class, Order, Family, Genus, Species

Explanation:

^

suggest what sort of molecules insulin receptors are and state where they would be found

Answers

The answer is water because

Please help now. I only have 3 minutes

Answers

Answer:

B

Explanation:

Other Questions
Read the excerpt from Barrio Boy by Ernesto Galarza. Hanging from a cord attached to the middle of the ceiling there was an electric bulb, low enough for an adult to reach and turn the black switch. I realized that this was our own electric light for us to turn on and off as we pleased. I pushed a chair under it and after some instruction from my mother proceeded to create lightning in the room by turning the switch as fast as I could. Which effective technique does the author mainly use to write this excerpt? What is times plus 4 Six more than the product of a number and -2 is 4. What type of breakfast does Lyddie receive? The atomic mass of an atom do not contain electrons becauseElectrons do not exist in all atoms.(a)Electrons are so small that it does not affect the mass of an atom.(b)Electrons are do not contain mass.(c)Electrons are not as important as protons and neutrons.(d) CWhich of the following is true of new media art?a. involves using the environment to create a piece of artb. involves combining a photograph and computer imagesc. combines and uses new, different, and innovative mediumsd. none of the above Help me anyone please Which of the following emerged in Western Europe in large part as a reaction to the diplomatic exchanges exemplified in the passage? lemme eat u ;) not like that weirdolove uuuu The timber production industry fuels the economy of which region?Puget Lowlands Olympic Mountains Willapa Hills Okanogan Highlands The different European philosophers influenced the revolutions of the 18th and 19th centuries. Explain what in those philosophies made people consider revolution possible. Which of these is describing a Eutrophic Lake?Mucky WaterCold WaterLow BiodiversityRocky BottomedPlz answer I need help thank you what does donca mean PLEASE HELP ASAP!!!!! Which of the following sentences should be rewritten into an active voice? A. The secret is known only by a few people. B. The experiment was conducted in Neilson's Lab. C. Today, the test was failed by me. D. The car was last seen on South Street. What is not one of the three main branches of the philosophy of art ? Chitto Harjo and his rebel group declared possession of 25 square miles of land at ___, during the Crazy Snake Uprising.A. Okmulgee, Indian TerritoryB. Muskogee, Indian TerritoryC. Hickory Ground, Indian TerritoryD. Boley, Indian Territory Subtract -2x^2+4x-12x 2 +4x1minus, 2, x, squared, plus, 4, x, minus, 1 from 6x^2+3x-96x 2 +3x96, x, squared, plus, 3, x, minus, 9.Your answer should be a polynomial in standard form. What is the measure of Angle D E F?4573107117 Help plz!!! A lighting designer for a movie has to light a dramatic scene that is outdoor in the rain where two actors are discussing a serious matter. The director wants the designer to come up with two lighting choices that can underscore the dramatic nature of the scene. Which lighting techniques could the designer use? Describe the techniques that you think the designer should choose and give the reasons for the choice.