Ps. Answer is B William meets Kate They both share many of the same beliefs and interests. Based on the effects of similarity on
attraction, which of the following is most likely to be William's reaction?
A William will be more likely to trust Kate than he would a stranger
B. William will be more attracted to Kate than he would a stranger.
C. William will be more likely to love Kate than he would a stranger
D. William will be more likely to distrust Kate than he would a stranger
Please select the best answer from the choices provided
A
Answer:
William will be more attracted to Kate than he would a stranger.
Explanation:
Option B is your answer choice. Have a great day ☺
On the effects of similarity on attraction, the following is most likely to be William's reaction, William will be more attracted to Kate than he would a stranger. Thus, option "B" is correct.
How they both share many of the same beliefs and interests?Research has found people tend to feel attracted to those who are similar to them, which is probably an evolved preference.
Still, there are several explanations for this liking. Psychologist says we believe people who are similar to us will be more likely to like us. Another reason would be that shared experiences and values make us feel more certain and positive in the world. Whatever reason it may be, the truth it psychology sees such tendency as deeply rooted in the human psyche.
Thus, option "B" is correct.
To learn more about psychology click here:
https://brainly.com/question/10980588
#SPJ2
Body fat in humans includes both essential and storage body fat.
a. True
b. False
Answer:
true
Explanation:
Answer:
yes that claim is actually true. those are the main fats (correct me if im wrong there)
f(x) = −16x2 + 60x + 16
Answer:
x = − 0.25 , 4
x = − 1 /4 , 4
Explanation:
DNA is normally found in the nucleus as
but condenses into
during cell division.
A. histones, chromosomes
B. chromosomes, chrothatin
C. chromatin, chromosomes
Answer:
The answer is chromatin and chromosomes.
Decide if the following statements best describe map-based genome sequencing, best describe whole-genome shotgun sequencing, or apply equally to both sequencing methods.
a. starts with libraries of large, overlapping DNA fragments
b. starts cloning and sequencing of short, random DNA fragments
c. uses genetic recombination data to help arrange sequences correctly
d. requires sequences to be annotated after contig assembly
e. requires chromosome fragments to overlap for contig assembly
f. requires subcloning of large fragments into smaller clones for sequencing
g. is a better approach for repetitive sequences
1. Map-based genome sequencing
2. Whole-genome shotgun sequencing
3. Both sequencing methods
Answer:
1. Map-based genome sequencing: a; c; f; g
2. Whole-genome shotgun sequencing: b
3. Both sequencing methods: d; e
Explanation:
Map-based genome sequencing is a method that makes use of a reference genome sequence in order to determine the relative position of the DNA fragments before they are sequenced. This method is useful to determine the position of repetitive DNA fragments (for example, duplicated genes, repetitive non-coding regions, etc.) and Transposable Elements. Therefore, map-based genome sequencing is a suitable approach for large genomes (which are usually composed of repetitive sequences). On the other hand, in whole-genome shotgun sequencing, DNA sequences are obtained before the correct order of these DNA fragments is known. In this method, the genome is fragmented randomly into small DNA sequences (between 100 and 1000 base pairs), which are subsequently sequenced through the chain-termination sequencing approach (i.e., Sanger sequencing) and finally ordered by using bioinformatic tools that assemble overlapping reads.
Process 2 is known as
Answer:
Transcription
Explanation:
From the available diagram, process 2 converts, or transcribe or copies DNA nucleotide sequence information into RNA sequence information.
Hence, in this case, the correct answer is TRANSCRIPTION
Please help!!!
Which structure is smaller?
A. Chromosome
B. Histone
C. Nucleosome
Answer:
B. Histone because they are a family of small positively charged proteins.
What is the slowest moving weather front. Why
is it so slow?
Answer:
Cold fronts
Explanation:
how did natural disasters affect animal populations?
Answer:
When disasters hit, animals experience the same terrible effects as people: injury, starvation, thirst, displacement, illness and stress. We move fast to protect animals affected by earthquakes, floods, typhoons and other disasters. We provide food, water, medical care, and other emergency assistance to animals in need
Explanation:
The __
__from farmland is often contaminated with pesticides, herbicides,
fertilizers, and oils used in farm equipment.
A. ammonia buildup
B. runoff
C. livestock
D. acid rain
Answer:
B. Runoff
Explanation:
can someone please help me with this!
Answer:
large teeth is dominant on small
Answer:
50%
Explanation:
It's a chart based thing but I don't have one, but it's for sure 50%
Which structure in the heart'separates
oxygenated blood from deoxygenated blood?
Answer:
pericardium
Explanation:
A double-walled membrane, the pericardium, separates the right and left chambers, preventing oxygen-rich blood from mixing up with the one without oxygen. So, the heart functions go smoothly. Deoxygenated blood enters the right atrium.
which statement is correct about the polarity of a water molecule
Answer:
Water is Polar
Explanation:
There is no overall charge to a water molecule, but there is a slight positive charge on each hydrogen atom and slight negative charge on the oxygen atom.
Some students correctly made a life cycle model for two specific animals. One group has made a model showing three parts, and another group has made a model showing four parts. Which parts would the group modeling incomplete metamorphosis have in their model?
A. egg, larva, adult
B. egg, nymph, adult
C. egg, larva, pupa, adult
D. egg, pupa, nymph, adult
RNA: CATTGGCTAACGTCGATAATCGTCGGTAC
9. Which amino acids would be found in the mutation protein?
Which amino acids would be found in the mutation protein
Answer:
Amino acid sequence: Valine- Threonine- Aspartic acid- Cysteine- Serine- Cysteine- Stop.
Explanation:
This question is describing the process of translation, which is the second stage of protein synthesis. Translation is the process whereby a mRNA template is used to produce amino acids, which forms a sequence that will eventually become protein.
The mRNA sequence is read in a group of three nucleotides called CODON. Each codon specifies a particular amino acid. According to this question, using the genetic code table, the given DNA sequence is as follows:
DNA: CAT- TGG- CTA- ACG- TCG- ATA- ATC- GTC- GGT- AC
RNA = GUA- ACC- GAU- UGC- AGC- UAU- UAG- CAG- CCA- UG
Amino acid sequence: Valine- Threonine- Aspartic acid- Cysteine- Serine- Cysteine- Stop.
write any two uses of Rocks and Minerals of each?
Answer:
The use of rocks and minerals includes building material, cosmetics, cars, roads, and appliances.
Explanation:
The process of meiosis is illustrated here. The outcome of meiosis is very important in the sexual reproduction and life cycle of
diploid organisms. Evaluate these statements and determine which ones accurately describe the outcome of meiosis. You may select
ALL that apply.
-)
A)
Meiosis produces genetically diverse cells.
B)
Meiosis increases genetic variation in the offspring.
C)
Meiosis produces haploid cells from a diploid parent cell
D)
Meiosis increases the genetic content in the daughter cells.
E)
Meiosis maintains the number of chromosomes originally present in the
parent cell.
Answer:
A) Meiosis produces genetically diverse cells.
B) Meiosis increases genetic variation in the offspring.
C) Meiosis produces haploid cells from a diploid parent cell
Explanation:
Through crossing over, meiosis produces genetically diverse cells causing more genetic variation of offspring. The Daughter cells in meiosis are formed from a diploid cell that has all 46 chromosomes, however the daughter cells are haploids as they need to join with the other gamete to have a full set of chromosomes.
14. Which nitrogenous base isn't found in DNA?
Answer:
Uracil is a nitrogenous base found in all RNA but not present in DNA.
Explanation:
plz mark brainliest
Answer:
UracilExplanation:
Uracil is a base found in RNA (but not in DNA) and derived from pyrimidine; pairs with adenine. Uracil the nitrogenous based is not found in DNA.
So, the final answer is Uracil.
The result of a magma plume rising and decompression melting occurring may
be the formation of a small volcanic region called a(n).
Please select the word from the list that best fits the definition
movement of molecules from an area where there are many to an area where there are few
Answer:
Diffusion
is the movement of molecules from an area where there are many to an area where there are few
Hope it helps
2. Which is an example of interspecific competition?
blue jays eating seeds from my bird feeder
white-tailed deer looking for food in a field
polar bears praying on seals in the artic ocean
squash outgrowing lettuce in my garden
1. Geologists use physical properties to identify minerals. For example, the blank
cleavage, color, fracture, hardness, luster, specific, gravity, streak, texture
Answer:
The correct answer is - crystal form (external shape).
Explanation:
Physical properties are used for the identification of the minerals that include specific gravity, streak, texture, luster color, hardness, cleavage, and crystal form.
The most common physical property of the minerals in crystal form or external shape of the mineral. This is the property of the mineral that gives an idea about the homogenous possessing a 3-D internal order.
Answer:
crystal form external shape
Explanation:
i copied lol
Newborn infants that are exposed to nitrate poisoning are said to be suffering from also known as .
Answer:
Methemoglobinemia.
Explanation:
Choose all the answers that apply.
Which of the following energy sources harms the
environment?
A.) coal
B.) hydroelectric power
C.) nuclear power
D.) oil
Answer:
c nuclear power because it destroy the places
Base your answers to the following question on the structures represented in the diagram.
Review Packet- Modern Genetics Name___________________________ Page 1
What is the relationship between these three structures?
Group of answer choices
Protein is composed of DNA that is stored in the cell
The cell is composed only of DNA and protein
DNA is made up of proteins that are synthesized in the cell
DNA controls the production of protein in the cell
Why human cell is consider as eukaryotic cell where as bacteria cell as prokaryotic cell?
Which of the following statements about lichens are true?
Answer:
The photobiont supplies the association organic carbon from photosynthesis, and the mycobiont ensures protection and regulates the supply of minerals and water. The nutritional exchange between partners is probably much more complex than exchange of water and minerals for organic carbon. Thus, the correct answer is option B.
Answer:juegan maincra
Explanation:porque si
I NEED HELP, can someone make do this real quick?
Answer:
The answer is A because abc
what is deposition ?
Answer:
it is a geological process where sediments, soil, and rocks are added to a landform or mass
Answer:
Deposition is defined as the removal from an office or the testimony of a witness under oath. An example of deposition is the firing of a person from a government job. An example of deposition is to tell the details of the crime to an attorney before the case goes to court
Explanation:
hope this helps
You suggest using a logistic growth model instead. Your colleague agrees, and recommends harvesting the bass population down to just under carrying capacity. Their argument is that the population will remain large and population growth will be fastest if it is harvested down to this size. A) Why is this argument incorrect
Answer and Explanation:
The error of this argument is to state that a population will remain large and increase when it is close to the carrying capacity. This is because the carrying capacity is the term that determines that a population of living beings is living in an environment that has the minimum resources for their survival, because that population has already consumed the resources. In this case, when a bass population comes close to carrying capacity, the amount of environmental resources is starting to become scarce or limited, this will cause a decrease in the size of the population, because many members of the population will not have access to the necessary resources and will die, decreasing the population. In addition, reproduction among members of the population will be reduced, which will prevent the population from remaining large, since the mortality rate will be higher than the birth rate.