Answer:55 degrees
Explanation:In order for an adult monarch to fly, temperatures need to be above 55 degrees Fahrenheit.
Answer:
Temperatures need to be above 55 degrees Fahrenheit.
Explanation:
4. When a kangaroo jumps, the kangaroo's action force acts on the ground, what would be the
reaction force?
acts on the kangaroo
c. lesser than the action force
b. exerted by the ground
d. greater than the action force
a
Answer:
D
Explanation:
because after the jump it will gain force forst
A man is 1.7 m long. An amoeba is 17 um long. How does the length of the
man compare to the length of the amoeba?
What is the difference between poison and medicine? How can we use science to figure out the difference.
Will mark u brainliest.
Answer:
not sure how to go about this question so if I'm wrong please tell me
Explanation:
The difference between poison and medicine is that poison is used to harm to one's health whether its an animal or human while medicine is used to cure an illness or an injury. We can use science to figure out the difference by testing the substance on an animal or stem cells of a human scientists do this various times to be assured of its outcome.
Nutrients can come from what 3 natural sources?
Answer:
Nutrient-rich soil or water contains large amounts of nitrogen, carbon, phosphorus, sulfur, and potassium. These nutrients can come from natural sources, like plant and animal remains. As plants and animals die, they decompose. Decomposition releases nutrients into the environment.
*MAY* give brainliest!
Please give answer and explain:
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.
ATTTGCATACTACCGGGC
The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.
Group of answer choices
ATTTGCAATACTACCGGGC
ATGAATGCATACTACCGGGC
ATTTGCATACTGACCGGGC
ATTTGCAACTACCGGGC
ATTAGCATACTACGGGC
Answer:
which are the letters with hightlight yellow?
What two elements are major building blocks in glucose, fructose, and sucrose?
A. Nitrogen and iodine
B. Carbon and hydrogen
C. Carbon and fluorine
D. Phosphorus and helium
Answer:
B
Explanation:
Did John Dalton use an observational study, a controlled experiment, or a mathematical model?
Answer:
we need a picture! if you provide one, then i can help in comments
Explanation:
Why is the cycling of matter vital to the success of an ecosystem?
Answer:
This is essential because all organisms depend on one another and is vital for the survival of living organisms. These organisms are linked by the flow of nutrients which is engineered by the nutrient cycles.
what are the roles of plate tectonics in the continental shelf?
Answer:
t
Explanation:
Answer:
A continental shelf is a portion of a continent that is submerged under an area of relatively shallow water known as a shelf sea. Much of these shelves has been exposed during glacial periods and interglacial periods. The shelf surrounding an island is known as an insular shelf.
Explanation:
what’s the similarities of red bloods cell and animal cells
Answer: they both have a:
Nucleus. The nucleus can be thought of as the cell's headquarters.
Plasma membrane. To ensure each cell remains separate from its neighbor, it is enveloped in a special membrane known as the plasma membrane.
Cytoplasm.
Lysosomes and peroxisomes.
Cytoskeleton.
Endoplasmic reticulum.
Golgi apparatus.
Mitochondria.
A scientist is studying the population dispersion of an animal. She is trying to determine whether the population is clumped or uniform.
Describe how having clumped dispersion may benefit a population.
Answer:
three advantages an individual organism might have by living in a population with a clumped dispersal pattern is...
1. Strength in numbers, if a predator tries to attack, there is a better chance they will be fine
2. Finding a mate, they won't have to go far to find someone, there all here.
3. It will be easier to find food since there all together.
Explanation:
as for clumped or uniform, this pic should clear things up.
Each student in a science class of 25 performed the same experiment. Each student shares their data and it is
recoded on a class data table. Tamara compared the data that she personally collected in her experiment to the
data collected by the rest of her classmates.
Which of the following might indicate to her that her results are valid?
Answer: three other classes performed the same experiment.
Explanation:
predation in your own words!!
Answer:
Its an interaction where one organism, the predator, kills and eats another organism, its prey
Explanation:
Which list places the layers of the sun in the correct order from innermost to outermost?
Corona, photosphere, chromosphere
Photosphere, convective zone, radiative zone
Convective zone, chromosphere, corona
Radiative zone, corona, convective zone
(the third choice is wrong)
Answer: The inner layers are the Core, Radiative Zone and Convection Zone. The outer layers are the Photosphere, the Chromosphere,
Explanation: Hope this helped! :)
Which landform is an area in a Koppen E zone?
A. desert
B. savannah
C. tundra
D. grassland
Answer:
D it is The Grassland
Explanation:
D it is The Grassland
Baking soda, Black coffee, Distilled water, Lemon juice out of these 4 item, which the strongest acid? How do you know?
Answer:
Baking soda is the strongest acid I think. I learned it in bio.
Explanation:
Hope this helps!
please answer. number 17
Answer: Carbohydrates
Explanation:
Phosphorus cycles between living things and the_.
Answer:
Non-living things.
Explanation:
The phosphorus cycle is the biogeochemical cycling of phosphorus, a very important element of living things, between the living and nonliving parts of our world.
Answer:
Dead things.
Explanation:
Also water, rocks, and the atmosphere.
The oxygen pulls harder on the shared electrons than hydrogen. The result of this is that the hydrogen have a __________?
None of the above
Partial negative charge
Partial positive charge
Answer:
b
Explanation:
Partial negative charge
Please anybody! I been struggling for a while now :(
Answer:
excess nitrates cause algae blooms
Explanation:
In the figure above, which letter represents the benthic zone?
Answer:
i believe the answer is C i am not 100% sure though. Im doing my best to help people on here im sorry if its wrong
Explanation:
Answer:
D
Explanation:
The benthic zone is the bottom of a body of water. Technically the benthic zone could go up to the shore but D is your best answer choice.
Which of the following is not true about prokaryotic cells?
Answer:
Prokaryotes lack a true nucleus with well defined nuclear membrane and other membrane-bound organelles. Mitochondria are the double membrane bound organelle and hence is absent in prokaryotes. Mesosome is an extension of the cell membrane presence in the cytoplasm as infolding and serves to increases surface area and as a site for cellular respiration in prokaryotes. Histones are positively charged proteins that serve in the packaging of negatively charged eukaryotic DNA but are absent in prokaryotes.
So, the correct answer is option A.(DNA is complexed with histones).
The statement which is not true for prokaryotic cell is that they are all parasitic. Thus, the correct option is C.
What is Prokaryotic cell?Prokaryotes are the organisms whose cells lack a nucleus and other membrane-bound organelles. Prokaryotic organisms are divided into two distinct groups which are the bacteria and the archaea, which scientists believe to have the unique evolutionary lineages. Most of the prokaryotes are small in size, single-celled organisms which have a relatively simple structure.
Examples of prokaryotic organisms are blue-green algae, bacteria and mycoplasma. Among the prokaryotes, bacteria are the most common and multiply very fast.
Therefore, the correct option is C.
Learn more about Prokaryotic cell here:
https://brainly.com/question/18348786
#SPJ6
Your question is incomplete, most probably the complete question is:
Which one of the following is not true of prokaryotes ?
(a) They are living cells
(b) They lack a nucleus
(c) They all are parasitic
(d) They are both archaea and bacteria
Which statement does NOT accurately describe eukaryotic and prokaryotic cells?
Answer:
You did not provide any options so i will give some facts that will hopefully help you in figuring out the correct answer.
For prokaryotic cells, the cell wall is a tough, fibrous layer that protects the cell and gives it shape and rigidity.
Prokaryotic cells are found in the domain(s) Bacteria and Archaea.
True: Prokaryotic cells have nucleoids and eukaryotic cells have nuclei.
A prokaryotic cell is distinct from a eukaryotic cell because a prokaryotic cell lacks _a nucleus_.
There is only _1_ eukaryotic domain, it is Eukarya.
When and how were the first trans fats made with vegetable oil?
Answer:
Artificial trans fat dates back to the early 1900s when German chemist Wilhelm Normann found that liquid vegetable or fish oils could be treated with hydrogen gas to make them solid or semi-solid.
A student places a beaker (container) with a small amount of liquid on the lab bench and
leaves it over night. The next day the beaker is empty.
Answer:
evaporation
Explanation:
the liquid evaporated over night
What property causes the cohesion of water molecules that moves water through a plant against the force of gravity?
Answer:
I believe the answer is polarity, though I am unable to find an exact statement.
Explanation:
I believe it is polarity because of the way water moves through a plant and its relation to gravity.
2. What is the process of making energy within mitochondria called?
Answer:
Mitochondria Function
Explanation
Cellular respiration is the process of making ATP using the chemical energy found in glucose and other nutrients. In mitochondria, this process uses oxygen and produces carbon dioxide as a waste product.
why must meosis and not mitosis be used to produce gametes
answer and explain
20 POINTS!!!!
Answer:
Explanation:
Meiosis only occurs in reproductive cells, as the goal is to create haploid gametes that will be used in fertilization. Meiosis is important to, but not the same as, sexual reproduction. Meiosis is necessary for sexual reproduction to occur, as it results in the formation of gametes (sperm and eggs).
Answer:
ten points each does not mean 20 points each
Explanation:
FIRST TO ANSWER IN DIFFERENT SENTENCES GETS BRAINLIEST
Answer:
1.An example of Batesian mimicry is when the yummy viceroy butterfly mimics the orange and black coloration of the distasteful monarch butterfly. ... Wasmannian mimicry occurs when the mimic resembles it's host (the model) in order to live within the same nest or structure. For example, several beetles closely resemble ants
2.Orange and black Monarchs (Danaus plexippus) are among the most familiar and easily recognizable butterflies found in the vivarium. Bright colors and distinctive wing patterns can be an example of aposematism, also known as a warning coloration.
Explanation:
please mark me as the brainliest answer and please follow me for more answers to your questions
How do ocean currents affect the paths of hurricanes?
