6×?×3=90 what's supposed to go in the ? Slot

Answers

Answer 1

Answer:

5

Step-by-step explanation:

6 x 3 = 18

90 / 18 = 5

Answer 2

Answer: 5

Step-by-step explanation:


Related Questions

You want to install a 1 yd wide walk around a circular swimming pool. The diameter of the pool is 23 yd. What is the area of the​ walk? Use 3.14 for π.

Answers

Answer:

415.48

Step-by-step explanation:

is the area

help your girl out, plz!!!​

Answers

Answer:

B. half the students answer 70% or 75% of the questions correctly

Which statements are true about the toolbox? Select two options.
The shape can be broken into a rectangular prism and a triangular prism.
The shape can be broken into a rectangular prism and a rectangular pyramid.
The formula for the volume of this figure is V = B h + one-third B h.
The volume of the toolbox is 840 inches cubed
The volume of the toolbox is 900 inches cubed

Answers

Answer:

Option A and E.

Step-by-step explanation:

It is mentioned that Chiyo has a toolbox having a  rectangular prism shape with a length of 8 inches, width of 15 inches, and height of 6 inches.

In addition to this, A triangular prism with a triangular base with base 8 inches and height 3 inches. The prism has a height of 15 inches.  

So here the shape can be broken into a triangular prism and rectangular prism

Therefore the first option is correct

Now as we know that

Volume of the rectangular prism is

= l×b× h

= 8 × 15 × 6

= 720

And, the volume of the triangular prism is bh

And, the area of the triangular prism is 1 ÷ 2 × b × h

= 1 ÷ 2 × 8 × 3

= 12

Now the volume is

= 12 × 15

= 180

So, the volume of the tool box is

= 720 + 180

= 900

Hence, the last option is correct  

Which fraction is equivalent to -3/2?

Answers

3/-2 so the first option

Ann has $ 1, $10, and $20 bills. She has 4 times as many $20 bills as $10 bills. She has 3 times as many $1 bills as $20 bills. She has a total of $204 . Drag and drop the number of $1, $10, and $ 20 bills she has.

Answers

Answer:

Ann has 24 $1 bills, 2 $10 bills, and 8 $20 bills.

Step-by-step explanation:

Given that Ann has $1, $10, and $20 bills, and she has 4 times as many $20 bills as $10 bills and 3 times as many $1 bills as $20 bills, taking a total of $204, to determine the number of $1, $10, and $20 bills she has, she needs to perform the following calculation:

1 = 3x20 = 3x4x10 = 12x10

20 = 4x10

10 = 10

(12 x 1) + (4 x 20) + 10 = 12 + 80 + 10 = 102

(24 x 1) + (8 x 20) + (2 x 10) = 24 + 160 + 20 = 204

So Ann has 24 $1 bills, 2 $10 bills, and 8 $20 bills.

Can you pleaseee help me

Answers

The answer is D. 2 you do the equation in prentice first

HELP ASAP!!!!!!!

What is the width of a rectangle if the area is 2x^2-x-6 and the length is 2x+3?

Answers

i’m not sure tbh,but you can use the app photomath and it should tell you!

I will give brainliest please help.

Answers

Answer:

135

Step-by-step explanation:

Multiplying the quotient and divisor can give the divended.

So, -9 x -15 = 135

This is same for the other boxes at the top, try multiplying for the other boxes of their quotient and divisor together and you'll get the same number as the divended written on the other boxes.

A helicopter is hovering over a landing pad 100 m from where you are standing. The angle of elevation with the ground is 12 degrees. What is the altitude of the helicopter rounded to the nearest tenth.

Answers

Answer:

Step-by-step explanation:

A helicopter is hovering over a landing pad 100 meters from where you are ... If the string is stretched straight, how high is the kite above the ground?

15. A particular compound decays according to the equation y = ae^-0.0736t, where t is in days. Find the half-life of this compound.

Answers

Answer:

12

Step-by-step explanation:

please i need help...................plz

Answers

Answer:

a = 10/1343 = 0.007

b = 500/199 = 2.513

c = 1/3 = 0.333

d+3,567-(0*d)=0

Step-by-step explanation:

Steven walked 1,095 feet in his neighborhood. How many yards did Steven walk?

Answers

Answer:

365 yards

Step-by-step explanation:

1085/3=365 yds

Hope this helped!!!

Multiply
5x (2)
I don’t get it

Answers

Answer:

10x

Step-by-step explanation:

A. 34
B. 55
C. 65
D. 145

Answers

answer is A, because of the alternate interior angles theorem

Help me answe this please lol

Answers

Answer:

SAS

is the correct answer of this question

Answer:

SAS

Step-by-step explanation:

SAS is an abbreviation for side angle side, which is what your triangle shows.

Which of the following best describes the equation below?

y = -2x2 - 4
A.
both linear and nonlinear
B.
neither linear nor nonlinear
C.
nonlinear
D.
linear

Answers

Answer:

I think it's C nonlinear

Step-by-step explanation:

Answer:

d

Step-by-step explanation:

use desmos calculator helps with these question

How many pieces of wire 3.6cm long can be cut from a coil of 1m long?What is the length of the piece left over?​

Answers

Answer:

We can get 27 pieces of wire 3.6 cm long and have a piece 7/9 cm left over

Step-by-step explanation:

Find the "unit length" by dividing 1 m by 3.6 cm:

  1 m

-----------

3.6 cm

Recall that 1 m = 100 cm.  Multiply the following by the conversion factor 100 cm / 1 m:

  1 m            100 cm

----------- * ----------------- = 27,7777777...

3.6 cm            1 m

We can get 27 pieces of wire 3.6 cm long and have a piece 7/9 cm left over (verify this by dividing 7 by 9 on a calculator).

Answer:

Solution :-

Pieces can be cut = 1/3.6

Pieces can be cut = 0.27 m

100 cm = 1 m

0.27 m = 27 cm

Therefore,

The length remaining of wire is 27 cm (approximately)

an airship flies 150 km with the wind and then turn around and flies back taking 5 hour and 30 min round trip. Find the speed of the airship in calm weather is 55 mph.

Answers

Answer:

150=(55-c)(5.5-t)

5.5-t=150/(55-c)

-t=(150-302.5+5.5c)/(55-c)

t=(152.5-5.5c)/(55-c)

150=(55+c)t   using t found about

150=(55+c)(152.5-5.5c)/(55-c)

8250-150c=8387.5-302.5c+152.5c-5.5c^2

5.5c^2=137.5

c^2=25

c=5

So the current is 5mph.

Step-by-step explanation:

15 POINTS!!! what is 70x11? ​

Answers

70 x 11 is 770 man man mana

Luis plans to purchase some new baseball bats and gloves before spring training begins. Luis wants to buy the same bats and gloves he purchased last spring, but he can’t remember the price of each item. Luis recalls making two purchases last spring, each totaling $135 and both tax exempt. The first purchase was for a glove and three bats. The second purchase was for two gloves and a bat. If the current prices of these items are the same as last spring, how much will Luis pay this spring for three gloves and four bats?

Answers

Answer:

Luis will pay for three gloves and four bats = $ 270

Step-by-step explanation:

Let the bats be represented by b and gloves by g, then according to the given conditions

3b+ g= $135----equation 1

b+ 2g= $135------equation 2

Subtracting equation 2 from eq. 1 gives

3b+ g= $135----equation 1

-b -2g= -$135------equation 2

2b -g = 0 --------- equation3

2b-g= 0

or 2b= g------ equation4

This means price of 2 bats is equal to price of 1 glove.

Putting value of g in eq. 1 from eq. 4

3b+ 2b= $ 135

5b= $135

b= 135/5= 27

Price of 1 bat = $ 27 and price of 1 glove= 2*27= $54

Luis will pay for three gloves and four bats

= 54*3 + 4*27

= 162+ 108

= $ 270

You finally got promoted to the next grade level. You and your friends go out to celebrate your success at Chuck E Cheeses. The total meal cost $70. There is a 15% tip with the meal. Which expression can you use to calculate the total cost of the meal with tip?


A. 0.15 (70)

B. 1.5 (70)

C. 1.15 (70)

D.11.5 (70)

Answers

Answer:

80 dollars and 50 cents.

Step-by-step explanation:

youd first multiply 70 by .15 which would equal 10.5. then add the 70 and 10.5 together. then you get your answer. so the expression youd want to use would be "x=70×.15"

A baker has a 20-kg bag of raisins. One-eighth of the bag is used in each batch of cookies. How much is used for 5 batches?

Answers

Answer:

12 1/2 kg

Step-by-step explanat

Answer: 12.5kg

Step by step:
20/8 = 2.5
2.5 kg = one batch
2.5 x 5= 12.5

Super urgent please help urgent

Answers

Answer:

A) the value is less than 67

Step-by-step explanation:

HELLLP!!! Which of the following is a true statement?

A) 3/4 > 13/16

B) 6/7 < 5/8

C) 1/3 < 24/72

D) 3/5 > 4/7

Answers

Answer:

C is the correct answer.

Step-by-step explanation:

All you have to do is divide 72 by three to get it into thirds and 1/3 is 24.

Answer:

D

Step-by-step explanation:

3/5>4/7

find the common denominator

the common denominator is 35

so since you multiply 7 to 5 to get 35 multiply 7 to 3

3/5 = 21/35

since you multiply 5 to 7 to get 35 multiply 5 to 4

4/7 = 20/35

21/35 > 20/35

In circle T with m∠STU=78 and ST=8 , find the length of arc SU. Round to the nearest hundredth.

Answers

Answer:

10.89

Step-by-step explanation:

The length of the arc SU in the circle T is 10.88 units.

What is circle?

A circle is a shape or a curve in a plane that has a fixed distance, called the radius, from a given point, called the centre.

Given that, in a circle T, m ∠STU = 78° and ST = 8, we need to find the length of arc SU,

The length of an arc = central angle / 360° × perimeter
= 78° / 360° × 3.14 × 16

= 10.88

Hence, the length of the arc SU in the circle T is 10.88 units.

Learn more about circle click;

https://brainly.com/question/29142813

#SPJ2

(b) In a lab, a substance was heated by 6 °C each hour for 48 hours. What was the total change
in temperature?
Х

Answers

Answer:

288 degrees celcius

Step-by-step explanation:

48 x 6 is 288

Answer:

The total change in temperature was 288* degrees.

Step-by-step explanation:

6 x 48 = 288

Ordered Pairs REMEMBER! There is only 1 output(y) for each input(x). Is this a function or not? (8,-3) , (3,8) , (9,4) , (-2,2)

Answers

answer:

a function

step-by-step explanation:

hello there!

as you said, there is only able one output ( y ) for each input ( x ) for it able to become a function

here is a little example of a "table" to help me explain this a little better for you!

input ( x ) | output ( y)

      8       |       -3

      3       |       8

      9       |       4

     -2       |       2

since none the inputs have more then one output then that means it is a function

hope this helps you and please let me know if i had made a mistake in the problem, have a wonderful day!! :D

30 points!!!

√8+√98+√32.​

Answers

Answer:

13√2 or 18.38478

Step-by-step explanation:

i hope this helps :)

Let us first resolve the given numbers into prime factors.

By prime factorization,

[tex] \longmapsto [/tex] √8 = √( 2 × 2 × 2)

[tex] \longmapsto [/tex] √8 = 2√2

⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀

[tex] \longmapsto [/tex] √98 = √( 2 × 7 × 7)

[tex] \longmapsto [/tex] √98 = 7√2

⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀

[tex] \longmapsto [/tex] √32 = √( 2 × 2 × 2 × 2 × 2)

[tex] \longmapsto [/tex] √32 = 2 × 2√2

[tex] \longmapsto [/tex] √32 = 4√2

According to the question,

[tex] \longmapsto [/tex] √8+√98+√32

[tex] \longmapsto [/tex] 2√2 + 7√2 + 4√2

Taking √2 as common.

[tex] \longmapsto [/tex] √2(2 + 7 + 4)

[tex] \longmapsto [/tex] √2(13)

[tex] \longmapsto [/tex] 13√2

So, we get that :

√8+√98+√32 → 13√2

What is the measurement of this angle?

Answers

The angle is 35 degrees.

9/10 - 1/2 can you help

Answers

Answer:

4/10 or 2/5

Step-by-step explanation:

9/10-1/2 = 9/10-5/10 = 4/10 = 2/5

Answer:

2/5

Step-by-step explanation:

9/10-1/2

9/10-1×5/2×5

9/10-5/10

9-5/10

4/10

2/5

Other Questions
ILL BRAINLIEST YOU IF YOU GET IT RIGHT What are references when applying for a job? Why should you wait before taking anti-inflammatories? HOLA POR FAVOR AYUDA:(necesito 3 ejemplos de tesis Jack invested $2,900 in an account paying an interest rate of 8 % compoundedannually. Anthony invested $2,900 in an account paying an interest rate of 81%compounded continuously. After 10 years, how much more money would Anthonyhave in his account than Jack, to the nearest dollar?I dont understand how to solve. I NEED HELP PLEASE HURRY The bank has 5 Vaults.Each vault contains 5 drawers 5 stacks and $25 whats in the bank? How many solutions will the equation have?| x 2| = 6 giving brainliest !!!!!!! What is equivalent to x+y+x+y+3(y+5)? explain the major resources of energy and write its impoetance What is the fraction equivalent of 430%NO LINKS. IF WRONG I WILL DELETE. I need this plz help In romeo and juliet passage 1 line 64, what does the phrase, content thee most closely mean?A. Be satisfiedB. Be rationalC. Be stillD. Be grateful Diego bought some raisins and walnuts to make trailmix. Raisins cost $4 a pound and walnuts cost $8 apound. Diego spent $15 on both ingredients. Decide ifeach pair of values could be a combination of raisinsand walnuts that Diego bought.Explain your answer. HELPP!!!!!!!!!!!!!!!! What transformation is shown below?reflectioncan't be determinedrotationtranslation In triangle ABC, angle A measures 50.5 degrees and angle B measures 74 degrees. What is the measure of angle C? DO NOT TRY TO PUT A DEGREE SIGN. JUST TYPE THE ANSWER!! - 1:Translate the following sequence into a short protein. Add hyphens between,please.235'- AUG GCA AAA GAG GAA CAU UAA - 3'56Second LetterUAGPheTyrSerUUUUUUCUUAUUGUCUUCCUCAUCGUAUUACUAAUAG39LeuStopStopUGUCys UUGCUGA Stop AUGG Trp GCGUCGCArgCGAGHisProCUUC | CCCUACUGCCULeu CCCCCACCGCAUCACCAACAGGin121st3rdCGGletterAsnSerlleAUUA AUCAUAAUGACUACCACAThrAAUAACAAAAAGAGUAGCAGAAGGU letterAG15Lys|ArgMet ACGAspGUUGGUCGUAGUGValAlaGCUGCCGCAGCGGAUGACGAAGAGGGUGGCGGAGGGGly|Duco18Gluhttp://biology.kenyon.edu/courses/biol114/Chap05/Chapter05.html1 Kailynn has been on a roll, and solving 5 math problems every 2.5 minutes. At this rae, how many problem will she solve in 30 minutes.