Answers
Answer:
B
Explanation:
can i get brainliest plz?
Related Questions
Number 15 which of the following is a function of carbohydrates?
Answers
Answer:
Option (c) cell wall.
Explanation:
Carbohydrates helps to forms the cell wall. Cellulose is a carbohydrate and it is found the plant cell wall.HELP IDK THE ANSWER SKSK
Answers
Answer:
The Goldilocks Zone?
Explanation:
The Goldilocks zone is a region that is close enough to the Sun to get the energy, and far enough to not burn up.
Answer: pretty sure thats right
Explanation:
*MAY* give brainliest!
Please give answer and explain:
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.
ATTTGCATACTACCGGGC
The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.
Group of answer choices
ATTTGCAATACTACCGGGC
ATGAATGCATACTACCGGGC
ATTTGCATACTGACCGGGC
ATTTGCAACTACCGGGC
ATTAGCATACTACGGGC
Answers
Answer:
which are the letters with hightlight yellow?
Which of the following actions would you take to remain safe in the lab?
Check all of the boxes that apply.
A bottle of liquid looks like water; you taste it to be sure.
While cutting a screen for an aquarium top, you point the scissors away from your body.
You pipette a liquid using a bulb pipette.
You heat a liquid by placing it in a plastic beaker on a hot plate.
You arrange all lab items neatly and make sure they are away from the edge of the lab table.
Answers
You arrange all lab items neatly and make sure they are away from the edge of the lab table.
You pipette a liquid using a bulb pipette.
The following guidelines should be included in most safety policies because they apply to practically all laboratories. They go on emergency preparedness, appropriate signs, safety gear, how to use lab equipment properly, and fundamental common sense standards.
Make careful to read any safety and fire alarm signs, and in the event of an accident or emergency, heed the directions.Make sure you are completely informed of the evacuation protocols for your building or facility.Make sure you are familiar with the location and proper use of all of the safety supplies in your lab, including eye wash stations, fire extinguishers, first aid kits, and safety showers.Be aware of the emergency phone numbers to call for assistance.Lab spaces with lasers, radioisotopes, and other biohazards need to be adequately labeled with warning signs.When working in the lab, avoid eating, drinking, and chewing gum.Never use laboratory glassware as a container for food or drink.Make sure to inspect your glassware for chips and cracks before each usage. Glassware that is broken should be reported to your lab manager so it can be disposed of properly.Never utilize lab equipment that you have not been given permission or been taught to use by your supervisor.Inform a technician as soon as possible if an instrument or piece of equipment malfunctions while in use or isn't functioning properly. Never attempt to fix a piece of equipment by yourself.
To know more about Lab guidelines visit:
https://brainly.com/question/2232090
#SPJ1
Which molecule is a source of carbon, hydrogen, and oxygen atoms for making proteins?
O water
O salts
O carbohydrates
O carbon dioxide
Answers
How many atoms of each element are in the chemical formula NH4NO3?
1 nitrogen, 1 hydrogen, and 3 oxygen
1 nitrogen, 4 hydrogen, and 3 oxygen
2 nitrogen, 4 hydrogen, and 3 oxygen
5 nitrogen, 1 hydrogen, and 1 oxygen
Answers
hope that helps :)
Which process connects glycolysis and the citric acid cycle?
lactic acid formation
acetyl CoA formation
electron transport
Krebs cycle
Answers
The process which connects glycolysis and the citric acid cycle is acetyl CoA formation.
GlycolysisGlycolysis is the reaction pathway busy which a glucose molecule is converted to two pyruvate molecules with the production of two net ATP molecules.
Citric acid cycleThis is a cyclic reaction pathway in which a mole of acetyl CoA is oxidized to two molecules of carbon (iv) oxide with the production of the reducing equivalents NADH and FADH2 as well as two ATP molecules.
Acetyl CoA formationThe pyruvate from glycolysis is oxidized to an acetyl CoA molecule by the pyruvate dehydrogenase complex. The acetyl CoA produced then enters the citric acid cycle.
Therefore, the process which connects glycolysis and the citric acid cycle is acetyl CoA formation.
Learn more about glycolysis, citric acid cycle and acetyl CoA at: https://brainly.com/question/11125539
Answer:
It's B
Explanation:
I took one for the team.
Each student in a science class of 25 performed the same experiment. Each student shares their data and it is
recoded on a class data table. Tamara compared the data that she personally collected in her experiment to the
data collected by the rest of her classmates.
Which of the following might indicate to her that her results are valid?
Answers
Answer: three other classes performed the same experiment.
Explanation:
Select the correct location on the image.
This diagram shows the functions of different enzymes during DNA replication. Which label would change if this process took place in aprokaryotic cell?
Answers
Answer:
DNA ligase
Explanation:
Answer: The nucleus
Explanation: I got it right on the test.
What speed do thorn bugs move at?
Answers
Answer:
they are not built for speed, and often move quite slowly.
Explanation:
<3
Describe one way the plants in a desert biome are adapted to survive?
Answers
Answer:
The leaves and stems of many desert plants have a thick, waxy covering. This waxy substance does not cover the stomata, but it covers most of the leaves, keeping the plants cooler and reducing evaporative loss. Small leaves on desert plants also help reduce moisture loss during transpiration.
Explanation: I hope this help's you some!!
What molecules will carry the electrons to the electron transport chain?
Answers
Answer:
electron and nuetrons
The molecules NADH and FADH₂ will carry the electrons to the electron transport chain.
These electron carrier molecules (NADH and FADH₂) are produced during the breakdown of glucose and other energy-rich molecules in the preceding steps of cellular respiration. They carry the high-energy electrons derived from these molecules to the electron transport chain, which is embedded in the inner mitochondrial membrane in eukaryotic cells.
The electrons passed through the electron transport chain ultimately combine with molecular oxygen to form water, which is the final electron acceptor in the chain.
Learn more about the electron transport chain, here:
https://brainly.com/question/33834922
#SPJ4
Which statement does NOT accurately describe eukaryotic and prokaryotic cells?
Answers
Answer:
You did not provide any options so i will give some facts that will hopefully help you in figuring out the correct answer.
For prokaryotic cells, the cell wall is a tough, fibrous layer that protects the cell and gives it shape and rigidity.
Prokaryotic cells are found in the domain(s) Bacteria and Archaea.
True: Prokaryotic cells have nucleoids and eukaryotic cells have nuclei.
A prokaryotic cell is distinct from a eukaryotic cell because a prokaryotic cell lacks _a nucleus_.
There is only _1_ eukaryotic domain, it is Eukarya.
Which statement is true? a. Earth’s revolution is circular. b. Earth’s revolution is elliptical. c. Earth’s distance from the Sun is constant. d. Earth’s average distance from the Sun is 2 astronomical units.
Answers
Answer:
B
Explanation:
1. Why were populations able to get so big? What happened that allowed this to happen?
2. What do you think will happen if the populations of humans continued to increase
3. What could happen that could limit the population or cause it to decrease ( Stop growing )
Answers
Answer:
1. reproduction
2. we could run out of food as not enough is produced fast enough
3. lack of food, women and men who are infertile or diseases which can kill people
Compare and contrast DNA to RNA, mention 3 points
Answers
Answer:
RNA is single-stranded while DNA is double-stranded. RNA contains uracil while DNA contains thymine. RNA has the sugar ribose while DNA has the sugar deoxyribose.
Please mark me as brainlist.Answer:
Differences -
DNA is made of sugar deoxyribose, RNA is made of sugar ribose
DNA is a double-stranded molecule, RNA is a single-stranded molecule
DNA is stable under alkaline conditions, while RNA is not stable
DNA stores genetic material, RNA converts information from DNA to proteins
Similarities -
Both store genetic infrmation
Both DNA and RNA consists of sugar, nitrogenous bases, and a phosphate backbone
Explanation:
HELPPPPPP ME PLEASEEE
Answers
Answer:
building blocks of life
Cells are the basic building blocks of living things. The human body is composed of trillions of cells, all with their own specialised function.
explain how matter behaves differently than energy in a ecosystem
Answers
Answer:
Energy and nutrients are passed around through the food chain, when one organism eats another organism. ... An example of energy flow in an ecosystem would begin with the autotrophs that take energy from the sun. Herbivores then feed on the autotrophs and change the energy from the plant into energy that they can use.
Which of the following is not true about prokaryotic cells?
Answers
Answer:
Prokaryotes lack a true nucleus with well defined nuclear membrane and other membrane-bound organelles. Mitochondria are the double membrane bound organelle and hence is absent in prokaryotes. Mesosome is an extension of the cell membrane presence in the cytoplasm as infolding and serves to increases surface area and as a site for cellular respiration in prokaryotes. Histones are positively charged proteins that serve in the packaging of negatively charged eukaryotic DNA but are absent in prokaryotes.
So, the correct answer is option A.(DNA is complexed with histones).
The statement which is not true for prokaryotic cell is that they are all parasitic. Thus, the correct option is C.
What is Prokaryotic cell?Prokaryotes are the organisms whose cells lack a nucleus and other membrane-bound organelles. Prokaryotic organisms are divided into two distinct groups which are the bacteria and the archaea, which scientists believe to have the unique evolutionary lineages. Most of the prokaryotes are small in size, single-celled organisms which have a relatively simple structure.
Examples of prokaryotic organisms are blue-green algae, bacteria and mycoplasma. Among the prokaryotes, bacteria are the most common and multiply very fast.
Therefore, the correct option is C.
Learn more about Prokaryotic cell here:
https://brainly.com/question/18348786
#SPJ6
Your question is incomplete, most probably the complete question is:
Which one of the following is not true of prokaryotes ?
(a) They are living cells
(b) They lack a nucleus
(c) They all are parasitic
(d) They are both archaea and bacteria
Is it possible for you to be more related to one grandparent than another?
Answers
Answer:
No because you should get half the DNA from your parents meaning you should be related to the grandparents equally
Answer:
The question isn't clear, can you restate it ?
Explanation:
what is the relation between weight of the body and weight of the heart
Answers
Which specialized cell type would be found lining the trachea, the part of the body that brings air to the lungs?
A)blood
B)epithelial cells
C)neuron
D)muscle cells
Answers
Answer:
epithelial cells
Explanation:
I hope it works <3
Answer:
Blood
Explanation:
Red blood cells are responsible for transporting oxygen to the different parts of the body.
Help I don’t get it the last one says negative
Answers
Answer:
Negative (Fourth Choice)
Explanation:
According to the question, it says "The flow of electrons is electricity." if the question talks about the electrons, then they are negative, because electrons are negatively charged.
Brainliest FIRST ANSWER! of the following is not a sub-atomic particle?
A.Electron
B.Neutron
C.Nucleus
D.Proton
Answers
Answer:
Nucleus
Explanation:
(integumentary system)
What type of cells are found in the system?
Are they different from other cells?
How do they work together to form the tissues needed to create the organs for the system?
Answers
Answer:
Its main functions are protection, absorption of nutrients, and homeostasis. In structure, it consists of a keratinized stratified squamous epithelium; four types of cells: keratinocytes, melanocytes, Merkel cells, and Langerhans cells.
Explanation:
Btw is your proflie pic a pic of Taehyung from BTS!??!?!?!?!?!!??!?!?!
Which phrase describes one main feature of the atmosphere
Answers
Answer:
protects earth's surface
I hope this helped you!
You state that the presence of water could accelerate the growth of bread mold. is this a
a)conclusion
b)analysis
c)hypothesis
d)experiment
Answers
Answer:
C. Hypothesis
Explanation:
If 5x+4y=58 and 3x + 7y = 67 find the value of ( x + y )
Answers
Explanation:
5x + 4y = 58 ....1
3x + 7y = 67 ....2
....1 × 3 both sides of the equation
15x + 12y = 174 ....3
....2 × 5 both sides of the equation
15x + 35y = 335 ....4
.....4 - ......3 both sides of the equation
35y - 12y = 335 - 174
23y = 161
y = 161/23
= 7
HELP ASAP 20 POINTS!!!!!!!!!!!!
2 ANSWERS
Answers
Answer:
A, and D
Explanation:
its the answer I believe
Answer:
Nitrogen, Calcium
Explanation:
im pretty sure.
write the names of Institute which involved in research of viruses
plz tell me fast
Answers
Answer:
The National Institute of Virology, Pune is an Indian virology research institute, and one of the translational science cells part of Indian Council of Medical Research (ICMR). It was previously known as 'Virus Research Center' and was founded in collaboration with the Rockefeller Foundation.
