6. Catalase is an enzyme that speeds up the breakdown of hydrogen peroxide. The enzyme increases the rate of reaction, so it is 700 times faster. If the enzyme reaction took 1.9s how long would the reaction take if there was no enzyme? Convert the answer to minutes. Give your answer to 4sf.

Answers

Answer 1

Answer:

0.00004524 minute

Explanation:

The enzyme is Catalase, and it speeds up the rate of reaction by 700 times than what it was supposed to be.

If the already sped up rate of reaction is 1.9 seconds, then the initial reaction ought to have taken

1.9/700 seconds and that is 0.0027143 second.

We're asked to convert to minute, we then have

0.0027143/60 which is equal to 0.0000452381 minute.

Since we're asked to round off to 4 significant figure, we have 0.00004524 minute.


Related Questions

Babies with very low or very high birth weight are less likely to survive. The graph shows the percentage of babies born at different weights.

A graph entitled Percentage of Babies born at Different Weights has weight in pounds on the horizontal axis, and percentage on the vertical axis. A small percentage of babies are born at the low and higher birth weights, and a greater amount are around 7 to 8 pounds.

Which statement is a valid claim that could be made using the data in the graph?
Directional selection is occurring because the graph favors an extreme.
Stabilizing selection is occurring because the average is favored.
Disruptive selection is occurring because the two extremes are favored.
Biodiversity variation is occurring because there is an increase in trait variation.

Answers

Answer:

C

Explanation:

Otherwise people wouldn’t have differences

Answer:

C!!! :))

Explanation:

I tookt the test and got it right.

Why might scientists be interested in using algae for biofuel production?

Answers

Answer:

Algae actively absorb carbon dioxide, and therefore reduce the greenhouse effect. Fuel from microalgae is called third-generation biofuel, and development for its production is currently underway. With sufficient information on the composition of biofuels, researchers can significantly improve production processes.

Explanation:

Describe one method to reduce the air pollutants released from a coal burning power plant

Answers

Answer:

A method to reduce the air pollutants released from a coal burning power plant is carbon capture.

Explanation:

Carbon Capture: It separates CO2 from emissions sources and recovers it in a concentrated stream. The CO2 can then be injected into the soil underground for permanent storage, or sequestration. Reuse and recycling can also reduce the environmental effects of coal production and use.

Chloroplasts contain ____, a green pigment that absorbs light energy.
A. an ovule

B. photosynthesis

C. a cuticle

D. chlorophyll

Answers

Answer:

d of course is this 7th grade?

Answer:

D. chlorophyll

Explanation:

sana nakatulong

Thank you to anyone who answers .

Answers

Answer:

D

Explanation:

Answer:

i think its D but im so sorry if it wrong my second answer would probably be A

Explanation:

i really hope this helps sorry if it doesn't

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Answers

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

Someone plz help me! ☺️

Answers

i think its amino acid

what is an indication that water is entering a cell?

Answers

Answer:

water decreasing from where it came from

Explanation:

that or the cell starts to swell

Write a scientific explanation as to “What is the main cause of global warming?"

Answers

Answer:

It is the aspect of climate change

Explanation:

Referring to the long term rise of planet's temperatures,it is caused by increased concentrations of greenhouse gases in atmosphere

Answer:

Excess C02 in the atmosphere caused by coal burning, exhaust, factory smokestacks, and deforestation.

Explanation: i am sorry if this is wrong

PLZZZ HELP MEEEE!!!

The horse latitudes are areas of calm bordered on either side by the prevailing westerlies and what other wind belts?

A. jet streams

B. polar easterlies

C. trade winds

D. doldrums

Answers

Answer:

es la c. trade winds o es la A. jet streams

In a sample of double stranded dna if 19% of the nitrogenous bases are guanine what percent of the nitrogenous bases are adenine

Answers

Answer:

31%

Explanation:

Chargaff's law says the amount of A (adenine) = T (thymine) and G (guanine) = C (cytosine). If

G = 19% then C= 19%

19% + 19% = 38%

100% - 38% = 62%

62% for A and T

Divide by 2 and you get

31%

16.2.2 Why is it important to complete a course of antibiotics?

Answers

It's because taking them regularly until the prescription is complete helps ensure that all of the illness-causing bacteria are killed or prevented from multiplying

Someone’s help me please

Answers

Answer:

trailmix

Explanation:

is the following truth or false? lava flows on the moon sometimes overlap highlands, showing that maria deposits are younger than highlands

Answers

Answer:

false

Explanation:

B) Now imagine that a hurricane has deposited large patches of light colored sand among the
rocks. Use the axes below to sketch how you think your graph from part A would change under
these new conditions. What type of selection is acting under these new conditions?

Answers

Here's li[tex]^{}[/tex]nk to the answer:

bit.[tex]^{}[/tex]ly/3tZxaCQ

I mark Branliest for the correct answer quickly please listen to me Eyes Blue

Answers

Answer:

1(i think)

Explanation:

The nucleus controls and regulates the activities of the cell (e.g., growth and metabolism) and carries the genes, structures that contain the hereditary information. Nucleoli are small bodies often seen within the nucleus. The gel-like matrix in which the nuclear components are suspended is the nucleoplasm.

Water in the blood helps carry nutrients and gases required foe survival througout the body. Which characteristics of water allow for this action?

A.water has a neutral pH
B.water maintains temperature
C.what expands when it freezes
D.water dissolves many compounds

Answers

Answer:

Water has a neutral pH

Explanation:

None of the others exactly fit in with what this is saying, and water having a neutral pH allows the supplies and nutrients that it carries to stay safe within it throughout the way.

Sorry if this isn't correct or full-fledged explained like I normally do, I saw you said to hurry up and I didn't do my normal research and whatnot.

Anyways, hope this helped!

Sources: N/A

The characteristic of water that allows this process of carrying nutrients and gases is water has a neutral pH. Thus, the correct option for this question is A.

What are the characteristics of water?

The characteristics of water are as follows:

It is a universal solvent. Due to the partial positive charge on hydrogen and partial negative charge on oxygen, it is a polar molecule. It has high heat capacity and high heat of vaporization. It has properties like cohesion and adhesion. Its solid form is less dense as compared to liquid.

Due to having the property of neutral pH, water significantly performs movement across the entire body with the help of blood.

It does not form any barrier with the differences in the level of pH. So, along with blood, water carries nutrients and gases that must be required for proper survival throughout the body.

Therefore, water that has a neutral pH is the characteristic property that allows the carrying of nutrients and gases required for survival throughout the body.

To learn more about The properties of water, refer to the link:

https://brainly.com/question/18681949

#SPJ6

If the carrot population increased, the rabbit population would:
NO LINK ANSWERS
A. increase
B. decrease
C. remain the same

Answers

Answer:

The rabbit population would remain the same as the increase in number of carrots doesn't determine / effect the population of rabbits.

Hope my answer helps !

Answer:

i believe the answer is c) remain the same

Explanation:

i say this because food availability wouldn't necessarily cause the population to grow (there would need to be an environmental change for this to happen.)

and the population wouldn't decrease because there would be an abundance of food and since starvation is one of the main causes of population decrease (along with over-crowding.)

good luck :)

i hope this helps

**please let me know if this was incorrect**

have a nice day!

What processes can increase the amount of atmospheric CO2?

Answers

Answer:

Explanation:

Carbon dioxide is added to the atmosphere naturally when organisms respire or decompose (decay), carbonate rocks are weathered, forest fires occur, and volcanoes erupt.

Carbon dioxide is also added to the atmosphere through human activities, such as the burning of fossil fuels and forests and the production of cement.

Answered by the One & ONLY #QUEEN aka #DRIPPQUEENMO

Hope This Helped !! :)

Human-induced emissions from fossil fuels contribute a relatively small amount of the increase in atmospheric CO2Deforestation and forest degradation reduces the removal component of this cycle, further increasing the carbon dioxide in the atmosphere

Body systems interact with one another to carry out life processes. Movement is an important function in animals. Which body
systems work with the skeletal system to enable voluntary movement of the organism? Choose ALL that apply.
A)
nervous system
B)
muscular system
C)
endocrine system
D)
lymphatic system
E)
circulatory system

Answers

A because the nervous system si the guy who helps ur body

Answer:

B

Explanation:

Because it's the muscle helps the body system with the skeletal system to enable voluntary movement of the organism

A cloud of dust and gas in space were stars are formed is a _____ .

Answers

Answer:

nebula

Explanation:

how does pollution travel from a river to the ocean?

a) pollution flows upstream toward the ocean

b) pollution flows downstream toward the ocean

c) pollution flows toward the bank of a river and then to the ocean

d) pollution flows toward the source of a river

Answers

Answer:

d

Explanation:

I would say d, because the other guy said d

Which of the following is an example of a producer-consumer
relationship?
productor?
Worm --> Bird
Leaf --> Tree
Fish --> Bear
Grass --> Deer

Answers

Answer:

Grass and Deer

Because Grass is consumer and Deer is producer

How is energy produced by respiration stored

Answers

Answer:

Explanation:

Cellular respiration converts the chemical energy stored in glucose into chemical energy stored in the ATP molecule. The cells break glucose down into carbon dioxide and water while producing energy that they store in ATP molecules.

Answered by the ONE & Only #QUEEN aka  #DRIPPQUEENMO

Hope this helped!!!

Which of these is NOT true about vaccines?
a. they simulate a specific immune response
b. they cause memory cells to be produced
c. they contain an antigen of a weakened pathogen
d. it has been proven that there are many possible negative side-effects to being vaccinated

Answers

Answer:

I'm going to say A

Explanation:

because it just make more sense

In rabbits, the gene for black fur is dominant over the gene for white fur. How can the appearance of white baby rabbits be explained when the mother has white fur, and the father has black fur?

Answers

Answer:

it is going to xx or xy those genes of the father and the father

Carbon, hydrogen, and oxygen from sugar molecules may combine with other elements to form other biomolecules. The picture
above shows an example of this. Examine the model and choose ALL of the statements that accurately describe the formation of the
new biomolecule.
A)
Proteins are being formed.
B)
The monomers are amino acids.
o
This is a hydrolysis reaction.
D)
Carbohydrates are being broken down.
E)
This is a dehydration synthesis reaction

Answers

B- the monomers are amino acids had the answer key last year

The following statements are true from the image;

Proteins are being formed.The monomer, are amino acids.

Many biomolecules are naturally occurring polymer substances. In this case the biomolecule that is being formed is a protein.

A protein is composed of several peptide bonds formed from amino acids. Hence, the monomer in this case are amino acids from which polypetides and proteins are formed.

Learn more: https://brainly.com/question/1443134

please answer this question asap!!!!

Answers

Answer:

The 2ND one and the 4th one I'm pretty sure

Which part of a DNA molecule is responsible for the direct coding of specific traits in an organism?

Answers

Answer:

i dont know i need points

Explanation:

12 POINTS!!

Semiconductors are materials that conduct electric current better than insulators but not as well as conductors.


Please select the best answer from the choices provided

T
F

Answers

Answer:

True

Explanation:

Hope this helps!

Answer:

True :)

Explanation:

Other Questions
The small pizza is 8 inch what the circumference plz help plz help me i need help I can do it but don't have time to think James raises chickens. He tracks the number of eggs his chicken lay at the end of each week. Is this relation a Function? Explain Please help me with this!!! what impact did the founding fathers have on america what does the sum of 223 and 45 equal??teacher asks a question but i'm over here thinking......French vanilla, rocky road, chocolate, peanut butter, cookie dough Scoop there is scoop there it is scoop!!!!Anyone else?? No just me okk! The product of a number and negative seven is at most negative eighty-four? What is the smallest value of the number? Eric drove 804 miles in 12 hours. At the same rate, how many miles would he drive in 8 hours? Does The translation between mRNA and amino acids is the same for all living things support the theory of evolution Qu prefieres?Ask your partner which of two foods he or she prefers. Your partner willanswer and ask you which one you prefer. Kyleigh invested $2800 in an account paying an interest rate of 5 1/2% compounded annually Ariana invested $2800 in an account paying in interest rate of 5 3/4%compounded continuously after 12 years how much more money with Ariana having her account then Kylie to the nearest dollar? Enter the VOLUME in the box below . (Please leave an explanation) Summarize in 3 sentences the effects of suburban growth in the 1950s. Mathhhh which numbers are under the ketchup spill 2. After Fertilization, this part of a female flower eventually becomes the fruitA. StyleB. PetalC. OvaryD. Sepal Draculaby Bram Stoker (excerpt)Then without warning the tempest broke. With a rapidity which, at the time, seemed incredible, and even afterwards is impossible to realize, the whole aspect of nature at once became convulsed. The waves rose in growing fury, each overtopping its fellow, till in a very few minutes the lately glassy sea was like a roaring and devouring monster.1Select the correct answer.Which motif does Stoker use in this excerpt from Dracula?A. bloodB. animalsC. natural forcesD. Christian iconography A KG object has a speed of 24 M/S if it has 14 J of kinetic energy what is the mass Which of the following best describes the message of the old man who fell into the river?Don't walk to close to the edge of the riverGo with the flowHold your breath and things will work out.take swimming lessons: you never know when you might need them.Based on taoism and i really need help Ernie is . All of these points on the same line because the slope between (0, 0) and (3, 3) equal to -4. Please help me with this