2 Label each of the diagrams below to show whether the seeds are spread by exploding pods, wind,
water or animals.

2 Label Each Of The Diagrams Below To Show Whether The Seeds Are Spread By Exploding Pods, Wind,water

Answers

Answer 1

Answer:

b: pineapple

d: coconut

e: beans

Explanation:

I think they all form.
Answer 2

Answer:

A. wind

B. animals

D. water

E. exploding pods

Explanation:


Related Questions

What molecules will carry the electrons to the electron transport chain?

Answers

Answer:

electron and nuetrons

The molecules NADH and FADH₂ will carry the electrons to the electron transport chain.

These electron carrier molecules (NADH and FADH₂) are produced during the breakdown of glucose and other energy-rich molecules in the preceding steps of cellular respiration. They carry the high-energy electrons derived from these molecules to the electron transport chain, which is embedded in the inner mitochondrial membrane in eukaryotic cells.

The electrons passed through the electron transport chain ultimately combine with molecular oxygen to form water, which is the final electron acceptor in the chain.

Learn more about the electron transport chain, here:

https://brainly.com/question/33834922

#SPJ4

Which statement is true? a. Earth’s revolution is circular. b. Earth’s revolution is elliptical. c. Earth’s distance from the Sun is constant. d. Earth’s average distance from the Sun is 2 astronomical units.

Answers

Answer:

B

Explanation:

Describe one way the plants in a desert biome are adapted to survive?​

Answers

Answer:

The leaves and stems of many desert plants have a thick, waxy covering. This waxy substance does not cover the stomata, but it covers most of the leaves, keeping the plants cooler and reducing evaporative loss. Small leaves on desert plants also help reduce moisture loss during transpiration.

Explanation: I hope this help's you some!!

Is it possible for you to be more related to one grandparent than another?

Answers

Answer:

No because you should get half the DNA from your parents meaning you should be related to the grandparents equally

Answer:

The question isn't clear, can you restate it ?

Explanation:

After transcription, the new mRNA strand travels to the cytoplasm and over to the ___________ where the genetic code will be translated into amino acids.

nucleus

cell membrane

ribosomes

golgi bodies

Answers

The answer is C ribosomes

After transcription, the new mRNA strand travels to the cytoplasm and over to the RIBOSOMES where the genetic code will be translated into amino acids.

During gene transcription, a specific fragment of DNA called gene is used to produce a complementary messenger RNA (mRNA) sequence in the cell nucleus.

Subsequently, this mRNA travels to the cytoplasm where it is used as a template to synthesize a polypeptide chain in the ribosomes by a process called translation.

Ribosomes are protein factories that read the genetic code in the mRNA sequence (i.e., the codons of the mRNA) to translate it into the correct order of amino acids of the protein.  

In conclusion, after transcription, the new mRNA strand travels to the cytoplasm and over to the RIBOSOMES where the genetic code will be translated into amino acids.

Learn more in:

https://brainly.com/question/241631?referrer=searchResults

write the names of Institute which involved in research of viruses
plz tell me fast​

Answers

Answer:

The National Institute of Virology, Pune is an Indian virology research institute, and one of the translational science cells part of Indian Council of Medical Research (ICMR). It was previously known as 'Virus Research Center' and was founded in collaboration with the Rockefeller Foundation.

HELP ASAP 20 POINTS!!!!!!!!!!!!
2 ANSWERS

Answers

Answer:

A, and D

Explanation:

its the answer I believe

Answer:

Nitrogen, Calcium

Explanation:

im pretty sure.

Which of the following actions would you take to remain safe in the lab?
Check all of the boxes that apply.

A bottle of liquid looks like water; you taste it to be sure.

While cutting a screen for an aquarium top, you point the scissors away from your body.

You pipette a liquid using a bulb pipette.

You heat a liquid by placing it in a plastic beaker on a hot plate.

You arrange all lab items neatly and make sure they are away from the edge of the lab table.

Answers

You arrange all lab items neatly and make sure they are away from the edge of the lab table.

You pipette a liquid using a bulb pipette.

The following guidelines should be included in most safety policies because they apply to practically all laboratories. They go on emergency preparedness, appropriate signs, safety gear, how to use lab equipment properly, and fundamental common sense standards.

Make careful to read any safety and fire alarm signs, and in the event of an accident or emergency, heed the directions.Make sure you are completely informed of the evacuation protocols for your building or facility.Make sure you are familiar with the location and proper use of all of the safety supplies in your lab, including eye wash stations, fire extinguishers, first aid kits, and safety showers.Be aware of the emergency phone numbers to call for assistance.Lab spaces with lasers, radioisotopes, and other biohazards need to be adequately labeled with warning signs.When working in the lab, avoid eating, drinking, and chewing gum.Never use laboratory glassware as a container for food or drink.Make sure to inspect your glassware for chips and cracks before each usage. Glassware that is broken should be reported to your lab manager so it can be disposed of properly.Never utilize lab equipment that you have not been given permission or been taught to use by your supervisor.Inform a technician as soon as possible if an instrument or piece of equipment malfunctions while in use or isn't functioning properly. Never attempt to fix a piece of equipment by yourself.

To know more about Lab guidelines visit:

https://brainly.com/question/2232090

#SPJ1

If 5x+4y=58 and 3x + 7y = 67 find the value of ( x + y ) ​

Answers

Explanation:

5x + 4y = 58 ....1

3x + 7y = 67 ....2

....1 × 3 both sides of the equation

15x + 12y = 174 ....3

....2 × 5 both sides of the equation

15x + 35y = 335 ....4

.....4 - ......3 both sides of the equation

35y - 12y = 335 - 174

23y = 161

y = 161/23

= 7

Compare and contrast DNA to RNA, mention 3 points

Answers

Answer:

RNA is single-stranded while DNA is double-stranded. RNA contains uracil while DNA contains thymine. RNA has the sugar ribose while DNA has the sugar deoxyribose.

Please mark me as brainlist.

Answer:

Differences -

DNA is made of sugar deoxyribose, RNA is made of sugar ribose

DNA is a double-stranded molecule, RNA is a single-stranded molecule

DNA is stable under alkaline conditions, while RNA is not stable

DNA stores genetic material, RNA converts information from DNA to proteins

Similarities -

Both store genetic infrmation

Both DNA and RNA consists of sugar, nitrogenous bases, and a phosphate backbone

Explanation:

explain how matter behaves differently than energy in a ecosystem

Answers

Answer:

Energy and nutrients are passed around through the food chain, when one organism eats another organism. ... An example of energy flow in an ecosystem would begin with the autotrophs that take energy from the sun. Herbivores then feed on the autotrophs and change the energy from the plant into energy that they can use.

Which statement does NOT accurately describe eukaryotic and prokaryotic cells?

Answers

Answer:

You did not provide any options so i will give some facts that will hopefully help you in figuring out the correct answer.

For prokaryotic cells, the cell wall is a tough, fibrous layer that protects the cell and gives it shape and rigidity.

Prokaryotic cells are found in the domain(s) Bacteria and Archaea.

True: Prokaryotic cells have nucleoids and eukaryotic cells have nuclei.

A prokaryotic cell is distinct from a eukaryotic cell because a prokaryotic cell lacks _a nucleus_.

There is only  _1_ eukaryotic domain, it is Eukarya.

HELPPPPPP ME PLEASEEE

Answers

Answer:

building blocks of life

Cells are the basic building blocks of living things. The human body is composed of trillions of cells, all with their own specialised function. 

what is the relation between weight of the body and weight of the heart​

Answers

300g in males 200g in females

Help I don’t get it the last one says negative

Answers

Answer:

Negative (Fourth Choice)

Explanation:

According to the question, it says "The flow of electrons is electricity." if the question talks about the electrons, then they are negative, because electrons are negatively charged.

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC

Answers

Answer:

which are the letters with hightlight yellow?

What speed do thorn bugs move at?

Answers

Answer:

they are not built for speed, and often move quite slowly.

Explanation:

<3

They often goes slow.

Which phrase describes one main feature of the atmosphere

Answers

Answer:

protects earth's surface

I hope this helped you!

HELP IDK THE ANSWER SKSK

Answers

Answer:

The Goldilocks Zone?

Explanation:

The Goldilocks zone is a region that is close enough to the Sun to get the energy, and far enough to not burn up.

Answer: pretty sure thats right

Explanation:

Which process connects glycolysis and the citric acid cycle?
lactic acid formation
acetyl CoA formation
electron transport
Krebs cycle

Answers

The process which connects glycolysis and the citric acid cycle is acetyl CoA formation.

Glycolysis

Glycolysis is the reaction pathway busy which a glucose molecule is converted to two pyruvate molecules with the production of two net ATP molecules.

Citric acid cycle

This is a cyclic reaction pathway in which a mole of acetyl CoA is oxidized to two molecules of carbon (iv) oxide with the production of the reducing equivalents NADH and FADH2 as well as two ATP molecules.

Acetyl CoA formation

The pyruvate from glycolysis is oxidized to an acetyl CoA molecule by the pyruvate dehydrogenase complex. The acetyl CoA produced then enters the citric acid cycle.

Therefore, the process which connects glycolysis and the citric acid cycle is acetyl CoA formation.

Learn more about glycolysis, citric acid cycle and acetyl CoA at: https://brainly.com/question/11125539

Answer:

It's B

Explanation:

I took one for the team.

How many atoms of each element are in the chemical formula NH4NO3?

1 nitrogen, 1 hydrogen, and 3 oxygen
1 nitrogen, 4 hydrogen, and 3 oxygen
2 nitrogen, 4 hydrogen, and 3 oxygen
5 nitrogen, 1 hydrogen, and 1 oxygen

Answers

C - 2 Nitrogen / 4 Hydrogen / 3 Oxygen

hope that helps :)

Brainliest FIRST ANSWER! of the following is not a sub-atomic particle?

A.Electron
B.Neutron
C.Nucleus
D.Proton

Answers

Answer:

Nucleus

Explanation:

You state that the presence of water could accelerate the growth of bread mold. is this a
a)conclusion
b)analysis
c)hypothesis
d)experiment

Answers

Answer:

C. Hypothesis

Explanation:

Which molecule is a source of carbon, hydrogen, and oxygen atoms for making proteins?
O water
O salts
O carbohydrates
O carbon dioxide

Answers

Carbohydrates is your answer because it’s the only molecule that provides energy of the 4 options

(integumentary system)
What type of cells are found in the system?
Are they different from other cells?
How do they work together to form the tissues needed to create the organs for the system?

Answers

Answer:

Its main functions are protection, absorption of nutrients, and homeostasis. In structure, it consists of a keratinized stratified squamous epithelium; four types of cells: keratinocytes, melanocytes, Merkel cells, and Langerhans cells.

Explanation:

Btw is your proflie pic a pic of Taehyung from BTS!??!?!?!?!?!!??!?!?!

1. Why were populations able to get so big? What happened that allowed this to happen?

2. What do you think will happen if the populations of humans continued to increase

3. What could happen that could limit the population or cause it to decrease ( Stop growing )

Answers

Answer:

1. reproduction

2. we could run out of food as not enough is produced fast enough

3. lack of food, women and men who are infertile or diseases which can kill people

Number 15 which of the following is a function of carbohydrates?

Answers

Answer:

Option (c) cell wall.  

Explanation:

Carbohydrates helps to forms the cell wall.  Cellulose is a carbohydrate and it is found the plant cell wall.

Which specialized cell type would be found lining the trachea, the part of the body that brings air to the lungs?
A)blood
B)epithelial cells
C)neuron
D)muscle cells

Answers

Answer:

epithelial cells

Explanation:

I hope it works <3

Answer:

Blood

Explanation:

Red blood cells are responsible for transporting oxygen to the different parts of the body.

when is hypothesis accepted as a theory by the scientific community

Answers

Answer:

A hypothesis is an idea that hasn't been proven yet. If enough evidence accumulates to support a hypothesis, it moves to the next step — known as a theory — in the scientific method and becomes accepted as a valid explanation of a phenomenon.

Select the correct location on the image.
This diagram shows the functions of different enzymes during DNA replication. Which label would change if this process took place in aprokaryotic cell?

Answers

Answer:

DNA ligase

Explanation:

Answer: The nucleus

Explanation: I got it right on the test.

Other Questions
how many inches smaller is a 13.26 inch worm than a 14.13 inch worm The north pole of a bar magnet is moved close to the north pole of a second bar magnet. What prediction best describes how the first magnet responds when it is released? It will move toward the second magnet because like poles repel. It will move toward the second magnet because like poles attract. It will move away from the second magnet because like poles repel. It will move away from the second magnet because like poles attract. I NEED HELP PLEASE !!! 1. Consider the following system of equations.x+y=52x-y=-2The solution to the system of equations: (12,7)Create a third equation that could be added to the system so that the solution does not change. An image of a cue ball striking the surface of a pool table is shown. All of the following describe the acceleration of the cue ball EXCEPT-A. the ball changed direction when it hit the side of the table.B. the ball traveled at 30 cm/s while it was moving.C. the ball was at rest until it was struck by the pool cue.D. the ball eventually came to a stop due to friction. oranges were on sale for $0.45 per pound. Leo bought 12.6 pounds. which expression shows how to determine the total cost of oranges?0. 12.60.450. 12.6-0.450. 12.6+0.450. 12.60.45 Which of these factors MOST affected the way people in the northern hemisphere lived during the last Ice Age?Hurry Simplify (6^7)^3. A. 6^21B. 42^3C. 6^10D. (1/6)^21 3. Earning of profit is regarded as the main objective of business? Explain by giving any 3reasons Which expression is equivalent to 4sin2(x) 8sin2(StartFraction x Over 2 EndFraction)? The scenario below is about citizenship statusValentina's mother was born in the U.S. territory of Puerto Rico, and her father was born in France. Her parents have lived in France for the past five years and just gave birth to ValentinaWhat is Valentina's citizenship status in the United States?o alienresidentUS citizen by law of soilUS citizen by law of bloodWhat is the answer please Three Square Market, a Wisconsin-based tech firm, made headlines after they offered implantable microchips to its employees. The controversy highlights a generational divide, with younger generations being less concerned about privacy and much more open to sharing their lives. The move to place technology inside of employees raises concerns about data privacy issues, the lack of legislation around the technology, and the long-term health implications for our bodies. Jake the dog just wants to find a good home and people to love him. After spending the first year of his life as a stray, he is eventually caught and taken to an animal shelter. While there, one family after another passes him by and adopts another dog instead. One day, Jake manages to escape. To create the most fitting climax, which event should happen next in the story? O A. Jake searches the city for a family, hoping that one day he can find some peace at last. A B. Jake saves a boy who has fallen down a well by barking and leading the police to the well. O C. Jake meets a cat, and together they go on a series of increasingly dangerous adventures. D. Jake narrowly avoids the dog catchers and reaches a farm where a loving family takes him in ANSWER QUICK PLEASE !!!What is the natural environment?A . the story of the Interaction of people forming societies, cultures, and civilizationsB . an Increase in the world's temperatureC . the natural world in which people, plants, and animals liveD . the process by which social Institutions are adopted on a global scale If the tax rate is 7%, what is the tax on a $60 stuffed animal? Q: How have the fields of anatomy and physiology changed over time and what led to these changes? The scatterplot shows the relationship between the number of slices of pizza eaten by each member of a football team (x) and the number of laps around the block the player could run immediately afterward (y). The equation of the regression line shown on the graph is y = 10 0.67x:Use the equation above to predict the number of laps a player who ate 7 slices can run. from The Five Orange Pipsby Sir Arthur Conan Doyle When I glance over my notes and records of the Sherlock Holmes cases between the years '82 and '90, I am faced by so many which present strange and interesting features that it is no easy matter to know which to choose and which to leave. Some, however, have already gained publicity through the papers, and others have not offered a field for those peculiar qualities which my friend possessed in so high a degree, and which it is the object of these papers to illustrate. Some, too, have baffled his analytical skill, and would be, as narratives, beginnings without an ending, while others have been but partially cleared up, and have their explanations founded rather upon conjecture and surmise than on that absolute logical proof which was so dear to him. There is, however, one of these last which was so remarkable in its details and so startling in its results that I am tempted to give some account of it in spite of the fact that there are points in connection with it which never have been, and probably never will be, entirely cleared up.from The Adventures of Sherlock Holmes by Sir Arthur Conan DoyleFrom which point of view is this story being told? A. first person B. The point of view changes. C. third person The communist party is the one major political party in I need this one, FAST PLEASE AND THANKYOU!!What is Maya Angelou's purpose in writing the poem "Caged Bird?"A.To show the terrible effects of not being free.B.To encourage people to capture birds and put them in cages.C.To shows that people can adapt to a lack of freedom.D.To admire the beauty of birds.