12 The points (-15, -3) and (-7, -1) both lie
in the graph of the linear function
y = f(x). What is the rate of change of
f(x) with respect to x?

Answers

Answer 1

  rate of change is 1/4

Step-by-step explanation:


Related Questions

Solve the following inequality.
4x - 3(x + 2) - 5 < 0
A. x < -2
B. XX-2
C. x < 11
OD. X > 11

Answers

Answer:

The right answer is C

Step-by-step explanation:

4x-3x-6-5<0

x-11<0

x<11

Which angle is supplementary to 15?

Answers

9514 1404 393

Answer:

  ∠14

Step-by-step explanation:

Angle 15 forms a linear pair with angles 14 and 16. Each of those is supplementary to angle 15. Only angle 14 is listed as a choice.

During a flu epidemic, 35% of the school's students have the flu. Of those with the flu, 90% have high
temperatures. However, high temperatures are possible for people who do not have the flu. It is estimated that
12% of those without the flu have high temperatures.
If a student has a high temperature, what is the probability that the student has the flu?

Answers

Answer:

0.8015 = 80.15% probability that the student has the flu

Step-by-step explanation:

Conditional Probability

We use the conditional probability formula to solve this question. It is

[tex]P(B|A) = \frac{P(A \cap B)}{P(A)}[/tex]

In which

P(B|A) is the probability of event B happening, given that A happened.

[tex]P(A \cap B)[/tex] is the probability of both A and B happening.

P(A) is the probability of A happening.

In this question:

Event A: Has high temperature.

Event B: Has the flu

Probability of a student having high temperatures:

90% of 35%(have the flu)

12% of 100 - 35 = 65%(do not have the flu). So

[tex]P(A) = 0.9*0.35 + 0.12*0.65 = 0.393[/tex]

Probability of having high temperatures and the fly?

90% of 35%, so

[tex]P(A \cap B) = 0.9*0.35 = 0.315[/tex]

If a student has a high temperature, what is the probability that the student has the flu?

[tex]P(B|A) = \frac{P(A \cap B)}{P(A)} = \frac{0.315}{0.393} = 0.8015[/tex]

0.8015 = 80.15% probability that the student has the flu

Solve 7+X - 15 = -2 2/3

5 1/3

10 2/3

20 2/3

6 1/3

Answers

Answer:

solve 7+x-15=-2 2/3

Step-by-step explanation:

7+x-15=-2 2/3 -8+x=-8/3 x=-8/3+8 x=16/3 first question answer second question answer 5 1/3 5*3+1/3 15+1/3 16/3 3rd questiin answer 10 2/3 10*3+2/3 30+2/3 32/3 solve by this method another question

Solve the following inequality for X.
-26 + 13x + 2 > 2 – 13x

Answers

Answer:

x > 1

Step-by-step explanation:

-26 + 13x + 2 > 2 - 13x -------Given

13x - 24 > 2 - 13x -------------Add like terms

26x - 24 > 2 -------------------Add 13x on both sides

26x > 26 ------------Add 24 on both sides

x > 1 (Divide 26 on both sides)

Have a great day!

if the length of segment A'B' is 12 units, what is the scale factor of the dilation?​

Answers

Answer:

if the length of segment A'B' is 12 units, what is the scale factor of the dilation?

Step-by-step explanation:

someone help me, is this correct ?

Answers

Answer:

no!!

Step-by-step explanation:

it's b!! simply solve for y by subtracting both sides by 3x and then dividing both sides by 2

Answer:

its b your answer choice is wrong

Identify the volume of a square pyramid with base edge length 18 cm and height 16

Answers

Answer:

1728

Step-by-step explanation:

which is greater 40 oz or 3 lb

Answers

Answer:

I think 3lb is greater

Step-by-step explanation:

Find the perimeter of this semi-circle with diameter, d = 52cm.

Answers

Answer:

Perimeter = 133.681 cm

or 52.63 inches.

Step-by-step explanation:

"So, the perimeter of a semicircle is 1/2 (πd) + d or πr + 2r, where r is the radius."

let's use,  πr + 2r

Diameter: 52

Radius: 26 (RAdius is half of the diameter)

πr + 2r (plug in)

pi x 26 + 2(26)

pi x 26 + 52

= 133.681 cm

or

= 52.63

Write out the first five terms of the sequence.

an = n - 5

Answers

Answer:

its A

Step-by-step explanation:

took the quiz

An angle with measure seven pi over 4 radians is in standard position. In which quadrant does its terminal side lies

Answers

Answer:

Step-by-step explanation:

what is the measurement?

Answers

this question involves trig

sinx=p/h -----> some people have  

cosx=b/h ----> curly brown hair  

tanx=p/b -----> through proper brushing

we have p and h in this question so we can use the first formula

[tex]sinx=\frac{23}{28} \\x=sinx^{-1} \frac{23}{28} \\x=55.2[/tex]

Answer:

55.2

Step-by-step explanation:

sinx= 23/28

multiple both sides by inverse sin

x= sin^-1(23/28)

x= 55.2

HELPPP ITS DUE TODAY!!!


Given the function rule h(x)=6x-1, find the value of h(3)

Answers

Answer:

put x=3 in equation we get

18-1

17 is the answer

A bus travels for 22 minutes from Greensburg to Pleasant Valley. Then it travels 16 minutes from Pleasant Valley to Red Mill. How many minutes does it travel?​

Answers

Answer:

22 + 16 = 38

Step-by-step explanation:

I hope you have a good day

If ∠X and ∠Z are complementary, and the measure of ∠Z is 45°, what is the measure of ∠X?

Answers

Answer:

The measure of ∠X is 45°.

Step-by-step explanation:

Complementary angles are two angles that have a sum of 90°.

I subtracted 45 from 90 (90-45) and got 45°.

what is 1/3 +4 x 3

If you answer correctly i will give 100 points and Brainiest :)

Answers

12 1/3 or 12.33.

EXPLANATION:
because of order of operations or PEMDAS, multiplication comes first.

4 x 3 = 12

so now we have 1/3 + 12.

So 12 1/3.

Which in decimal form is 12.33

PartA: Explain why x=6makes 4x-5< 19.

Answers

Answer:

It doesn't.

Step-by-step explanation:

If you plug in 6 in the x spots you will have:

4(6)-5 < 19

If you solve that, you will get:

19< 19

So considering that they are the same number, this doesn't make sense because it should be an equal sign.

Have a nice day!!! Please mark Brainliest!

PLEASE HELP FAST I WILL GIVE YOU BRAINLIEST
AABC - AQRS
Find the missing side length, n.
R
B.
12.5
5
2
А-
-C
4
10
n = [?]
Enter

Answers

Answer:

5

Step-by-step explanation:

yoy need to find hue multiplying factor, this is done by dividing one of the sides in QRS, by one in ABC. you can divide 10 by 4 to give you 2.5, and then multiply that by 2 to get 5

pls help
round to the nearest tenth, if needed.

Answers

Answer:

[tex]\pi[/tex] or 3.1

Step-by-step explanation:

The total area of the circle is [tex]3^2\pi[/tex]. The central angle of the shaded region is 40 degrees so we have to multiply [tex]3^2\pi[/tex] by [tex]\frac{40}{360}[/tex] or [tex]\frac{1}{9}[/tex]. 3 squared is 9 so 9[tex]\pi[/tex] times [tex]\frac{1}{9}[/tex] is just equal to [tex]\pi[/tex]. [tex]\pi[/tex]=3.14159265... rounded to the nearest tenth is 3.1

What is the area of this figure? 30yd 5yd 18yd 18yd 13yd 12yd

Answers

Answer:

50544

Step-by-step explanation:

18x18x13x12=50544

In a snail-racing contest, Noba’s snail crawled 1.677 m in 5 min.
About how far did the snail travel each minute?

Answers

Answer: 12 hours

Step-by-step explanation:

Let's set the speed as "s".

Remember that distance = speed * time

So, plugging the numbers given...

7 = s * 8.4

Divide both sides by 8.4

s = 5/6

Now, plug this into the distance = speed * time, with the distance being 10. Set the time as "t"

10 = 5/6 * t

Divide both sides by 5/6

12 = t

So, it would take 12 hours for the snail to crawl 10 miles.

Help what is the correct answer *answer and questions attached*

Answers

Answer:

B

Step-by-step explanation:

Hey circle is divided into 24 sectors are shown below the sectors were rearranged into the figure shown below by placing the sector side-by-side this figure can be used to derive the equation for the area of a circle which statement about the figure is true

Answers

Answer:

the answer is two

Step-by-step explanation:

The equation is

The figure is similar to a parallelogram , with a base length equivalent to the circumference of the circle and a height equivalent to the radius of the circle

What is a Circle?

A circle is a closed two-dimensional figure in which the set of all the points in the plane is equidistant from a given point called “center”. Every line that passes through the circle forms the line of reflection symmetry. Also, the circle has rotational symmetry around the center for every angle

The perimeter of circle = 2πr

The area of the circle = πr²

where r is the radius of the circle

The standard form of a circle is

( x - h )² + ( y - k )² = r²,

where r is the radius of the circle and (h,k) is the center of the circle

Given data ,

Let the radius of the circle be represented as r

Now , the equation will be

The circumference of the circle C = 2πr

And , the circle is divided into 24 sectors and it is placed side-by-side

The figure formed is in the shape of a parallelogram

The base length of the parallelogram = circumference of the circle

And ,

Height of the parallelogram = radius of the circle r

Hence , the base length is the circumference and height is the radius of the circle

To learn more about circle click :

https://brainly.com/question/28391204

#SPJ2

Can someone help me solve this please!

Answers

Answer:

a)

Point A: Quadrant 1

Point B: Quadrant 3

b)

x intercept: -2, 0

y intercept: 0, 1

c)

slope: 1/2 or 0.5

plz help will give crown

Answers

Answer:

x=8

Step-by-step explanation:

-2(8) would be -16 so -18 is still greater

Answer:

B

Step-by-step explanation:

all the others will have a value of more than -18. Only B makes sense.

Hope this helps! Have a great day

Equations from Graphs
Which is the equation of the given line in point-
Please help me

Answers

Answer:

A. y = -x + 8

Step-by-step explanation:

y = mx + c

m = [tex]\frac{y2 - y1}{x2 - x1}[/tex] = [tex]\frac{0 - 8}{8 - 0}[/tex] = -1

c = 8

=> The equation will be y = -1x + 8 or y = -x + 8.

please help ///// brainiliest

A 6 cm high cone has a volume of 128π cm3 What is its exact surface area?

A. 160π cm2
B. 96π cm2
C. 144π cm2
D. 104π cm2


No dam links

Answers

I think it would be D. 104

what is the diameter of a circle with a radius of 4.375"? 2.187" or 2.375" or 8.375" or 8.750"

Answers

DONT CLICK ON THE LINKS! It’s 8.750 BY THE WAY the radius is half the diameter so just add the radius by itself or multiply by 2

he point A has coordinates A(2, 4). What are the X-coordinates of A′ for the dilation D1.5(A)?

Answers

Answer:

(3,6)

Step-by-step explanation:

For dilation, you just multiply the coordinates by the scale factor (in this case 1.5) to get the answer! Hope that helps :)

Other Questions
Use the function below to find F(2).F(t) = 2x1/2^3t. 1/32O B.1/8O c.1/16OD.1/64 Can anyone figure this out? NO LINKS OR FILES . What event causes Lily to realize Rosaleen really loves her?A. Rosaleen stands up to T. Ray for Lily's pet. B. Rosaleen rescued Lily from a rabid dog.C. Rosaleen tells Lily "Happy Birthday!"D. Rosaleen asked to adopt Lily.The book is Secret life of bees. 100 POINTS AND A BRANILIES NO LINKS AND NO CRAZY ANSWER PLEASE FOLLOW THE DIRECTIONS choose your recipe and simplify the longer sentences into basic steps (make sure you have 5 positive commands and 2 negative commands). You may have to add some negative commands into the recipe if there aren't any what is the mRNA in TACCGGATGCCAGATCAAATC? What is the measure of A, the exterior angle of the triangle shown below?F. mA = 92, because 180 (50 + 38) = 92.G. mA = 272, because 180 (50 + 38) = 92 and 92 + 180 = 272. H.mA=78,because 5038=12and9012=78.J. mA = 88, because 50 + 38 = 88. One of the biggest challenges that we all face, at least inmy opinion it's a challenge, is making difficult decisions,life-altering decisions. These decisions are not onlydifficult to make, but they can also bring consequencesthat are not easy to live with. However, if decisions are wellthought out and carefully considered they will be easier tomake and easier to live with.What feedback would be most helpful feedback to give the writer of thisparagraph?A. Improve the spelling and grammar.B. Make the claim more personal.C. Revise the claim to make it clearer.D. Address a counterclaim. What is the surface area of the figure? 408ft^2 458ft^2 545ft^2 720ft^2 Driving instructors Mr. Adams and Mr. Bateman teach class independently of each other. Among Mr. Adamss students, 68% pass the driving test on the first try, while 74% of Mr. Batemans students pass the driving test on the first try. Suppose there are 40 students in Mr. Adamss class and 50 students in Mr. Batemans class. Let A = the proportion of students who pass the driving test on the first try from Mr. Adamss class and B = the proportion of students who pass the driving test on the first try from Mr. Batemans class. What is the probability that Mr. Batemans class has more students who pass on the first try?Find the z-table here.0.2660.5470.7340.765 plsss help (will report if scam) John mows 3 of his neighbors yards for $20 a yard. How much money did he make? Sculptural reliefs at Angkor Wat depicting the Churning of the Ocean of Milk suggest that the patron of the complex may have intended to intimidate his audience by depicting acts of violence intended to intimidate his audience by depicting acts of violence A aimed to produce a large number of heirs for posterity aimed to produce a large number of heirs for posterity B desired to become godlike by achieving immortality desired to become godlike by achieving immortality C sought to gain enlightenment through meditative practices Can you please help me How is inverted syntax used as a rhetorical device? Milo drinks 2/5 of a bowls of water in 1/3 of an hour. How many hours will it take Milo to drink an entire bowl of water? 1. Viajar en avin = Why are half-reactions used in redox reactions? What number makes the equation true? 35 + = 42 ANSWER THE QUESTION FOR BRAINLIESTANSWER THE QUESTION FOR BRAINLIESTANSWER THE QUESTION FOR BRAINLIESTANSWER THE QUESTION FOR BRAINLIESTANSWER THE QUESTION FOR BRAINLIESTANSWER THE QUESTION FOR BRAINLIESTANSWER THE QUESTION FOR BRAINLIESTANSWER THE QUESTION FOR BRAINLIESTANSWER THE QUESTION FOR BRAINLIESTANSWER THE QUESTION FOR BRAINLIESTANSWER THE QUESTION FOR BRAINLIESTANSWER THE QUESTION FOR BRAINLIESTANSWER THE QUESTION FOR BRAINLIESTANSWER THE QUESTION FOR BRAINLIESTANSWER THE QUESTION FOR BRAINLIEST Why can't a corona virus that infects a bird infect a human?