The first states in ancient Mesopotamia were: Sumer and Akkad. Sumer, located in southern Mesopotamia, was a collection of city-states that emerged around 4500 BCE.
These city-states, such as Ur, Uruk, and Eridu, were independent political entities with their own rulers, but they shared a common culture and religion. The Sumerians developed a system of writing called cuneiform and made advances in agriculture, mathematics, and astronomy.
Akkad, on the other hand, was a region in northern Mesopotamia that rose to prominence under the rule of Sargon of Akkad around 2334 BCE.
Sargon conquered the Sumerian city-states and united them under his rule, creating the first known empire in history, the Akkadian Empire. This empire brought together diverse cultures and facilitated the exchange of ideas, technology, and trade.
In conclusion, the first states in ancient Mesopotamia were Sumer, with its city-states, and Akkad, which later formed the Akkadian Empire under Sargon's rule. These early civilizations laid the foundation for subsequent empires, such as the Babylonian and Assyrian empires, and greatly influenced the development of human society.
To know more about Mesopotamia, refer here:
https://brainly.com/question/15662742#
#SPJ11
In response to the expansion of world capitalism in New Guinea, _______ combined aboriginal and Christian beliefs.
In response to the expansion of world capitalism in New Guinea, the people of the region combined aboriginal and Christian beliefs.
As colonial powers expanded into New Guinea and brought with them Western capitalism, many indigenous communities in the region sought ways to reconcile their traditional beliefs with the new economic and cultural influences. One way that they did this was by combining their ancestral beliefs with Christian practices and beliefs introduced by European missionaries.
This syncretic approach allowed indigenous communities to retain their cultural identity while also adapting to the changing world around them. The blending of traditional and Christian beliefs also facilitated the spread of Christianity in the region, as it became more accessible and relatable to the local population.
Learn More about capitalism
https://brainly.com/question/25879591
#SPJ4
What did King Louis XVI of France offer the Americas?
King Louis XVI of France offered: significant financial and military support to the Americas during the American Revolutionary War.
In response to your question about what King Louis XVI of France offered the Americas, the key terms to consider are King Louis XVI, France, financial support, military support, and American Revolutionary War.
King Louis XVI saw an opportunity to weaken Britain, a rival nation, by assisting the American colonies in their struggle for independence. After the American victory at the Battle of Saratoga in 1777, France entered into a formal alliance with the Americans.
This alliance, known as the Treaty of Alliance, provided the colonists with vital financial support, as France loaned money and supplied weapons, ammunition, and uniforms to the American forces.
Additionally, France offered military support in the form of troops, ships, and experienced officers. One notable figure who served as a volunteer was the Marquis de Lafayette, who played a crucial role in the war as a key aide to General George Washington.
French naval forces, under the command of Admiral de Grasse, also played a decisive role in the American victory at the Battle of Yorktown in 1781.
In summary, King Louis XVI of France offered financial and military support to the Americas during the American Revolutionary War. This support was essential in helping the colonists achieve victory and ultimately secure their independence from Britain.
To know more about Revolutionary War, refer here:
brainly.com/question/22135298#
#SPJ11
THIS IS an antisense ATGCGGAATTGGCGACATAA , Write the nucleotide sequence that would be translated from this strand of DNA?
The nucleotide sequence that would be translated from this strand of DNA is ATCGCTTAGAACCGCATTCTT.
Nucleotide sequence is a string of nucleotides, which are the basic units of genes and genetic information. Nucleotides are made up of three parts: a phosphate group, a sugar molecule (deoxyribose), and a nitrogenous base.
The nitrogenous bases come in four different types—adenine (A), guanine (G), cytosine (C), and thymine (T). Every gene consists of an ordered sequence of these four bases. Different sequences of these compositions determine the physical characteristics expressed by an organism.
To know more about nucleotide sequence visit:
https://brainly.com/question/17105264
#SPJ4
8) How free were Americans (in particular, women, African-Americans, and Japanese-Americans) in the years before and during World War II? To answer this question, you should use the Four Freedoms—as defined by the President and Norman Rockwell—as the standard.
Many Japanese Americans were forced to live in poor, cramped circumstances with barbed wire fences around them and armed guards for many years.
Japanese Americans lost not only their homes, companies, property, and money but also their liberty, security, and fundamental liberties that are equally the property of all Americans. I have always held the opinion that great countries confront their most trying times head-on, learn from them, and become stronger as a consequence.
The imprisonment of Japanese Americans 80 years ago serves as a warning to us about the awful results we invite when we let racism, xenophobia, and other forms of bigotry thrive.
Learn more about Japanese Americans here:
https://brainly.com/question/14585867
#SPJ4
true or false
the soviet union is to blame for the beginning of the cold war
explain your opinion- who was to blame for the breakdown of post war talks between the U.S. and the USSR? why?
How and why did employer-employee relationships change during the Industrial Revolution?
Relationships change during the Industrial Revolution as foundation of huge plants obliterated those immediate connections, offering proprietors less chance to lay out an individual interest in laborers.
The Industrial Revolution changed economies that had been founded on horticulture and handiwork into economies in view of enormous scope industry, motorized assembling, and the manufacturing plant framework. Existing industries were made more productive and efficient by new machines, new power sources, and new ways to organize work. Opportunities for employment increased as a result of the Industrial Revolution.
Compared to what farmers were earning, factory wages were higher. As factories spread, more managers and workers were needed to run them, which led to an increase in the number of jobs available and overall wages.
Learn more about Industrial revolution :
brainly.com/question/13323062
#SPJ4
what songs describe your day and why it matters?
Inspirational songs are the finest way to start the day. It matters because songs can influence one's mood throughout the day.
What is the significance of songs?Music has the power to uplift people's emotions, energize them, or calm and relax them. Music also allows us to feel almost all, if not all, of the emotions we experience in our daily lives.
Music, whether listened to or made, increases blood flow to parts of the brain that generate and regulate emotions. The limbic system, which is involved in mood processing and memory management, "lights" up when we hear music.
Learn more about songs at:
https://brainly.com/question/900187
#SPJ1
For the following books and concepts, name the author and say how it contributed to pessimism: (Psychoanalysis)
Psychoanalysis is a psychological theory and therapy developed by Sigmund Freud in the late 19th and early 20th centuries. While psychoanalysis itself may not have contributed to pessimism, some of its ideas and implications have been seen as pessimistic.
Freud's theories emphasized the role of the unconscious mind and the ways in which unresolved childhood conflicts and repressed memories can shape adult behavior.
He also introduced the concept of the "death drive," which suggests that humans have an inherent desire for self-destruction and an inability to ever achieve true happiness.
These ideas have been interpreted as pessimistic because they challenge the notion of free will and suggest that humans are inherently flawed and incapable of ever fully understanding or controlling their own minds.
Additionally, Freud's focus on the negative aspects of human experience, such as anxiety, guilt, and repression, can be seen as emphasizing the darker side of human nature.
To know more about Psychoanalysis refer here
https://brainly.com/question/29869553#
#SPJ11
What was the one major advantage that allowed the small Portuguese fleet to dominate the Indian Ocean militarily?
The one major advantage that permitted the little Portuguese armada to rule the Indian Sea militarily Their installed gun could overcome different boats and beachfront fortifications.
Europeans had found the subtle water course to the rewarding Indian Sea exchange organization. The Portuguese technique in the Indian Sea was to overwhelm exchange using capability, terrorizing, and ruthlessness. their boats could outgun and outsmart contending maritime powers.
Their boats could outgun and outsmart contending maritime powers, while their installed cannons could annihilate beachfront fortresses. The point of Portugal in the Indian Sea was to guarantee the imposing business model of the flavor exchange.
Learn more about Portuguese:
https://brainly.com/question/31344706
#SPJ4
What provision did New York City make for its homeless in the early 1870s?
In the early 1870s, New York City made provisions for its homeless population by establishing temporary shelters and aid programs. These provisions aimed to provide basic necessities like food, clothing, and a place to sleep for the city's homeless individuals.
In response to the growing homeless population, New York City opened up shelters, also known as "lodging houses," to provide temporary housing for those in need. These lodging houses were often supported by philanthropic organizations and religious institutions that provided funding and resources to help the city's homeless population.
In addition to lodging houses, aid programs were established to offer food and clothing to homeless individuals. "Soup kitchens" and charitable organizations distributed essential items to those in need.
Job placement services were also created to help homeless individuals find employment and eventually transition to stable housing.
In summary, New York City made several provisions for its homeless population in the early 1870s, including establishing temporary shelters, aid programs for food and clothing, and job placement services. These measures aimed to alleviate the struggles the city's homeless individuals faced and help them regain stability in their lives.
To learn more about homelessness, visit: https://brainly.com/question/31607626
#SPJ11
how did the erie canal affect the american industrial revolution?
Answer: helped facilitate access to coal reserves in Pennsylvania, reducing American dependence on imported coal
Explanation:
Give a definition or explanation of greenstone belts and include the age of the oldestknown greenstone (or supracrustal) belt.
Greenstone belts refer to geological formations that consist of primarily volcanic rocks and sedimentary rocks that have undergone intense metamorphism. The Isua Greenstone Belt is the oldest known greenstone belt, dating back approximately 3.8 billion years.
These belts are typically found in Archean and Proterozoic rock sequences, and they are believed to have formed during periods of active tectonic activity and volcanic eruptions.
Greenstone belts are important as they often host economically significant mineral deposits, such as gold, silver, and copper. These belts also provide valuable insight into the early evolution of the Earth's crust and the processes that led to the formation of continents.
The oldest known greenstone belt is the Isua Greenstone Belt in southwest Greenland, which has been dated to be approximately 3.8 billion years old. This belt is believed to have formed during the early stages of the Earth's formation and provides important clues about the conditions that existed on the planet during that time.
In summary, greenstone belts are geological formations composed of primarily volcanic and sedimentary rocks that provide valuable insights into the early evolution of the Earth's crust and host economically significant mineral deposits. The Isua Greenstone Belt is the oldest known greenstone belt, dating back approximately 3.8 billion years.
For more about Greenstone belts:
https://brainly.com/question/31322244
#SPJ11
Where did the Germans mostly immigrate in the American colonies?
Answer:The central colonies
Explanation:the greatest part of this immigration, especially Pennsylvania. As many as half of these immigrants came as redemptioners, that is, they agreed to work in America for four to seven years in exchange for free passage across the Atlantic.
during the immediate postwar years, native americans group of answer choices saw themselves as rival members of independent nations. became equal partners in western settlement. refused to see themselves as conquered peoples. never ceded land in exchange for goods.
During the immediate postwar years, Native Americans refused to see themselves as conquered peoples and instead saw themselves as rival members of independent nations. The correct option is refused to see themselves as conquered peoples.
They recognized that they had been colonized and mistreated by the United States government, but they did not want to be seen as subordinate to them. Instead, they wanted to assert their own sovereignty and independence, and they saw themselves as equal partners in the western settlement. Native Americans never ceded land in exchange for goods, as they believed that their land was sacred and belonged to them.
They also resisted attempts by the government to assimilate them into white culture, and instead fought to preserve their own traditions and way of life. Despite facing many challenges and obstacles, Native Americans continued to resist colonialism and assert their own rights and autonomy, paving the way for future generations to fight for their own sovereignty and independence. The correct option is refused to see themselves as conquered peoples.
For more about independent nations:
https://brainly.com/question/2139879
#SPJ11
After winning their national independence, many countries subsequently sought to break their dependence on foreign imports and increase the range of commodities manufactured domestically. This policy is commonly referred to as:
The policy commonly referred to as breaking dependence on foreign imports and increasing domestic manufacturing is known as import substitution industrialization (ISI).
The idea behind ISI was that by producing goods domestically, these countries could reduce their reliance on foreign imports and promote economic development and self-sufficiency. ISI involved implementing protectionist policies, such as tariffs and quotas, to limit imports and encourage domestic production. Governments also provided subsidies and other incentives to support the development of domestic industries. While ISI did lead to some successes in terms of industrialization and economic growth, it also had some drawbacks.
For example, protected industries often became inefficient and uncompetitive, and consumers had limited access to imported goods. Overall, ISI was a strategy that aimed to promote economic development and reduce dependence on foreign imports. While it had some limitations, it played a significant role in the economic policies of many newly independent countries.
Learn more about import substitution industrialization here:
https://brainly.com/question/30243911
#SPJ11
Why was Nigeria formerly under a command economic system?
Nigeria formerly operated under a command economic system because type of centrally planned economy.
This system was implemented in the 1960s when Nigeria gained independence from Britain. The main goal of the command economic system was to reduce income inequality and promote industrialization. Under this system, all production and pricing decisions were made by the government.
The government would control all imports, exports, and foreign investment. It would also determine wages and prices for goods, as well as regulate all business activities. This system ultimately failed due to corruption and lack of incentives for producers, leading to an inefficient economy with high levels of poverty.
To know more about command economic system visit:
https://brainly.com/question/28423244
#SPJ4
How does Lee Coker respond to Amos Hicks and his criticism of Janie?
Describe some ways in which the Taliban soldiers destroy Kabul
The Taliban soldiers destroy Kabul by swarming the dilapidated Kabul museum and smashed pre-Islamic statues to rubble.
The Taliban, which also calls itself the Islamic Emirate of Afghanistan due to the name of its country, is a radical political movement of Deobandi Islamic fundamentalism and Pashtun nationalism in Afghanistan. He ruled three-quarters of the country from 1996 to 2001 before being overthrown after the US invasion. He recaptured Kabul on August 15, 2021, after nearly 20 years of insurgency, and currently controls the entire country, although his government is not recognized by any country. The Taliban government has been criticized for restricting women's and girls' human rights, including their right to work and education, in Afghanistan.
To know more about Taliban click on the link below.
brainly.com/question/12326725
#SPJ4
Many settlers in Florida and Georgia were upset with the Seminoles because they
A. attacked Spanish forts without warning.
B. provided safe havens for runaway slaves.
C. declared loyalty to the French government.
D. competed with southern agricultural exports.
Option B is entirely correct. Many settlers in Florida and Georgia were upset with the Seminoles because they provided safe havens for runaway slaves.
What exactly are seminoles?The Seminoles are a Native American tribe that first appeared in Florida in the 18th century. Today, they are divided into three federally recognised tribes: the Seminole Indian Nation of Oklahoma, the Seminole Tribe of Florida, and the Miccosukee Tribe of Indians of Florida, as well as autonomous organisations. The Seminoles evolved from several Native American groups who immigrated in Spanish Florida beginning in the early 1700s, most notably the northern Muscogee Creeks that originated in what is now Georgia and Alabama.
To know about seminoles visit:
https://brainly.com/question/15526672
#SPJ1
This chart shows a sequence of causes and effects in how banking can affect society. Complete the chart by selecting the correct word.
First: The Fed reduces interest rates.
Second: Banks will make (more or fewer?) loans.
Third: The money supply (increases or decreases?).
Fourth: People and businesses are (more or less) likely to spend and borrow money.
Fifth: The number of jobs will (decrease or increase?).
Sixth: People will buy (more or fewer?) cars, homes, and fun stuff.
Seventh: Growth of the economy speeds up.
Eighth: Inflation will (decrease or increase?).
The correct word that tells us what would happen when the Fed reduces interest rates has been filled in below
What happens when the fed reduces interest rate?The interest rate is the percentage by which the benefits of saving money woud grow. When people save money, the money would generally earn an interest overtime
First: The Fed reduces interest rates.
Second: Banks will make more loans.
Third: The money supply increases.
Fourth: People and businesses are more likely to spend and borrow money.
Fifth: The number of jobs will increase.
Sixth: People will buy more cars, homes, and fun stuff.
Seventh: Growth of the economy speeds up.
Eighth: Inflation will increase.
Read more on interest rate here:https://brainly.com/question/25793394
#SPJ1
even in the north which group was a regular part of commerce linking north american, africa, and europe? group of answer choices skilled craftsmen and shopkeepers sons of wealthy gentry university-trained puritans slaves and indentured servants
The group that played a regular part in commerce linking North America, Africa, and Europe, even in the North, was the "slaves and indentured servants." The correct option is slaves and indentured servants.
This group was an essential component of the transatlantic trade system known as the Triangular Trade. This system involved the trade of goods, raw materials, and people among the three continents. The main components of the Triangular Trade were the exchange of manufactured goods from Europe for enslaved people from Africa, who were then transported to North America and the Caribbean.
Though slavery and indentured servitude were more prevalent in the Southern regions of North America, they were still present in the North, contributing to the commercial success of the region. The Triangular Trade enabled merchants in the North to profit from the sale of goods and raw materials, fostering economic growth and development.
In summary, slaves and indentured servants played a significant role in commerce that linked North America, Africa, and Europe, even in the northern regions. They were an essential part of the Triangular Trade system, which facilitated economic growth and prosperity throughout the colonies. The correct option is slaves and indentured servants.
For more about indentured servants:
https://brainly.com/question/4850869
#SPJ11
Why was the early Chinese writing important for the Chinese
The early Chinese writing system was important for the Chinese because it was the foundation of their culture and communication.
What is culture ?Culture is the practices, beliefs, values, and behaviors that make up the unique identity of a group of people. It is the way of life shared by a particular society or population, and can include language, customs, values, norms, and traditions. Culture shapes how people interact with one another and the world around them, and it is constantly evolving and adapting in response to changes in the environment. It involves everything from the way people dress and speak, to their diets and religious beliefs. It also includes ideas, stories, and art that are created and shared by the members of the culture. Ultimately, culture is the collective identity of a group of people and is an important part of human experience.
To learn more about culture
https://brainly.com/question/29285761
#SPJ1
Answer: early Chinese writing was essential for the preservation of culture, communication, governance, and the development of a shared cultural identity
Explanation:
why were many abolitionist groups an extension of the church
The reason why many abolitionist groups serves as an extension of the church was that some of the Enlightenment philosophers opposed slavery and most of them are Christian activists.
What was abolitionist groups?The groups can be described as the fragmented anti-slavery movement which were been set up so they can come against the act of slavery they some of the group which can be seen as the Liberty Party; the American as wellas the Foreign Anti-Slavery Society.
Itshould be noted that the American Missionary Association as wellas other group rised up so that they can come against this and some of them are Christian activists.
Learn more about abolitionist at:
https://brainly.com/question/1818846
#SPJ1
All of the following were important patrons of Dutch seventeenth century art EXCEPTA. popesB. guildsC. private individualsD. civic organizations
Popes did not play a significant role in the patronage of Dutch seventeenth-century art, as the Netherlands was a Protestant country and there was little contact between the Dutch artists and the papacy. The correct option is A.
The Dutch Golden Age, a period of economic and cultural prosperity in the Netherlands during the seventeenth century, saw a flourishing of artistic production, particularly in painting.
During this time, many patrons played an important role in supporting artists and commissioning artworks.
Among the most prominent were private individuals, who were often wealthy merchants, nobles, or members of the bourgeoisie.
They commissioned paintings for their homes or as gifts, and their tastes and preferences helped shape the direction of Dutch art.
Guilds, and associations of craftsmen, also played a significant role, commissioning artworks for their headquarters and sponsoring competitions and exhibitions.
Civic organizations such as city governments, churches, and hospitals were also important patrons of art, commissioning works for public spaces or as part of religious or civic ceremonies.
to know more about Patronage of Dutch refer here:
https://brainly.com/question/12881231#
#SPJ11
Which statement about Joan of Arc is true?
Responses
Option B is one that accurately describes Joan of Arc, she said that she had received command from God to lead French troops in combat with English invaders.
Who is Joan of Arc?Joan of Arc, also known as the Maid of Orleans, was a French national heroine who played a pivotal role during the Hundred Years' War between England and France. Born in 1412 in Domrémy, France, she claimed to have received visions from God instructing her to lead the French army to victory against the English. At the age of 17, she convinced the French Dauphin to allow her to lead the army and she subsequently won several key battles, including the lifting of the siege of Orleans. She was found guilty and burned at the stake in 1431, but was later exonerated by the Catholic Church and canonized as a saint in 1920.
Learn more about Joan of arc here,
brainly.com/question/497316
#SPJ1
Complete Question:
Which statement about Joan of Arc is true?
A. She was a Benedictine nun who predicted that France would fall to King Edward III.
B. She said that God had told her to lead French troops against the English invaders.
C. She was executed by King Charles of France for losing the Battle of Crecy.
D. She commanded English forces in a siege against the French city of Orléans.
which were primary reasons the magazine industry moved to smaller, more specialized publications in the 1950s?
The primary reasons the magazine industry moved to smaller, more specialized publications in the 1950s
were due to a changing market and the need to cater to specific interests of readers.
1. Competition from television: The 1950s saw a surge in the popularity of television as a new medium for entertainment and news. As television gained more viewership,
the magazine industry had to adapt to this change by focusing on niche markets and creating specialized content to stay relevant and maintain their audience.
2. Targeted advertising: Advertisers were looking for more targeted ways to reach their desired audience.
Smaller, specialized publications provided a better platform for them to reach specific demographics and interests, ensuring that their ads would reach the right people.
3. Diversification of interests: With the post-World War II economic boom, people's interests became more diverse as they had more time and resources for leisure and personal pursuits.
Smaller, specialized publications were able to cater to these specific interests and hobbies, providing readers with content that was relevant and interesting to them.
4. Increasing literacy rates: As more people became literate in the 1950s, there was a growing demand for a variety of reading materials. Smaller,
specialized publications were able to meet this demand by offering content tailored to the interests and preferences of their readers.
In conclusion, the magazine industry's shift to smaller, more specialized publications in the 1950s was primarily driven by the need to adapt to the changing market, cater to theing diversify interests of readers, and provide targeted advertising opportunities for businesses.
This strategy allowed the industry to remain relevant and competitive in the face of emerging media, such as television.
To know more about magazine industry refer here
https://brainly.com/question/14103533#
#SPJ11
The fresco cycle of the life of Christ in the Arena Chapel of Padua was painted byA. CimabueB. GiottoC. MasaccioD. Fra Angelico
Giotto's use of light and shadow, perspective, and spatial composition helped to create a sense of depth and realism in the frescoes, setting a new standard for painting in Italy. The correct answer is B. Giotto.
His work in the Arena Chapel had a profound influence on the development of Renaissance art and continues to be admired and studied by art historians and scholars today.
The fresco cycle of the life of Christ in the Arena Chapel of Padua was painted by the Italian artist Giotto di Bondone (c. 1267-1337).
The Arena Chapel, also known as the Scrovegni Chapel, was commissioned by Enrico Scrovegni, a wealthy Paduan banker, in the early 14th century.
Giotto's frescoes in the chapel are considered to be a masterpiece of Western art and a turning point in the development of Italian Renaissance art.
The cycle depicts scenes from the life of Christ, from the Annunciation to the Last Judgment, and is notable for its emotional intensity, naturalistic style, and careful attention to details of human anatomy and movement.
to know more about Giotto's frescoes refer here:
https://brainly.com/question/19613771#
#SPJ11
in 1890, the sherman anti-trust act was enacted. what was it's purpose, and how did it effect organized labor?
In 1890, the Sherman Anti-Trust Act was enacted. Its primary purpose was to regulate and prevent monopolistic practices by large corporations, as well as to promote economic competition. This legislation aimed to prohibit trusts, cartels, and other business arrangements that could potentially hinder fair competition within the marketplace.
The impact of the Sherman Anti-Trust Act on organized labor was significant. Initially, the Act was not only used to target big corporations, but it was also applied to labor unions. Courts often viewed unions as potential restraints on trade, as they could limit the supply of labor and drive up wages.
Consequently, unions were sometimes prosecuted under the Act, which led to the weakening of the labor movement during this period.
However, as the interpretation of the Sherman Anti-Trust Act evolved over time, its application to labor unions diminished. In 1914, the Clayton Antitrust Act was passed, which explicitly exempted labor unions from being considered as monopolies or illegal combinations.
This allowed organized labor to regain strength and continue advocating for better working conditions and wages for their members.
In conclusion, the Sherman Anti-Trust Act of 1890 was enacted to prevent monopolistic practices and promote competition. Initially, its impact on organized labor was negative, as unions were prosecuted under the Act.
However, with the passage of the Clayton Antitrust Act in 1914, unions were exempted from the law, allowing them to continue fighting for workers' rights.
To know more about monopolistic practices refer here
brainly.com/question/12652861#
#SPJ11
after fulfilling the ideal of manifest destiny and expanding its territory to the pacific ocean, why did the united states shift from a policy of isolationism to imperialism? (5.1) a. to find new markets to sell goods and acquire raw materials b. to find new territory to relieve overcrowding in cities c. to discover new technology to improve industrial efficiency d. to compete with european nations by establishing colonies in africa
After fulfilling the ideal of manifest destiny and expanding its territory to the Pacific Ocean, the United States shifted from a policy of isolationism to imperialism primarily to find new markets to sell goods and acquire raw materials (option A).
This shift was driven by a need to fuel the growing American economy and maintain its competitive edge on the global stage.
As the United States industrialized, it needed access to new resources and markets for its manufactured goods. Expanding its global influence allowed the country to secure these resources and markets, helping it become a significant player in international trade.
Additionally, the United States wanted to compete with European nations (option D), who were also establishing colonies around the world. By engaging in imperialism, the U.S. could assert its power and influence on a global scale, aligning with the idea of American exceptionalism.
While options B and C may have been secondary motivations, they were not the primary reasons for the shift from isolationism to imperialism. Acquiring new territory to relieve overcrowding in cities (option B) and discovering new technology to improve industrial efficiency (option C) were not the main driving forces behind this policy change.
In summary, the United States shifted from isolationism to imperialism to find new markets to sell goods and acquire raw materials, as well as to compete with European nations by establishing colonies and expanding its global influence.
To know more about imperialism refer here
https://brainly.com/question/30210572#
#SPJ11
About how long did the Portuguese trading empire in the Indian Ocean flourish?
The Portuguese trading empire in the Indian Ocean flourishes in Less than a century.
The option (B) is correct.
Portugal's motivation in the Indian Sea was to guarantee the imposing business model of the zest exchange. Exploiting the contentions that set Hindus in opposition to Muslims, the Portuguese laid out a few fortresses and general stores. By 1600, the Portuguese general store realm started by Vasco da Gama in 1497 was at that point in steep downfall.
The Indian Ocean was the focal point of world exchange. A wide range of shipping lanes crossed its waves. These courses connected the South China Ocean to the Indian Sea to the Mediterranean Ocean.
Learn more about trading empire:
https://brainly.com/question/2574969
#SPJ4
This question is not complete, Here I am attaching the complete question:
About how long did the Portuguese trading empire in the Indian Ocean flourish?
a) Nearly four centuries
b) Less than a century
c) Less than 50 years
d) About two centuries